Dataset for CDS BAX-like of Organism Carassius gibelio

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A897TCE8_BAX-01 BCL2-associated X gene OS=[Eukaryota] Carassius gibelio GN=BAX (length=615 residues).
atggcagatgcgaacgatggagagaggacagacgagaaagagttgatgggggctacgggcggtgaagatgtcatggatga
tgtgatcatcgaacggagtgccgttttactaagacagtatgttattgaacaagtaactgtagaggatccctcaatgcatg
tgagtcacgaggatctaggaggcagacctcacgatgcagatgaccctcaaatcaaagatgttgtagatcagcttttgaag
atagccgatgaccttaacaagaatgctgaacttcaacatctcatcagctctgtggaatcaaactgtgctcaggacgtctt
catgactgtggccaggagcatcttcgaggatggcattaactggggacgtgtggtggctctgtttcacctcgcatataggc
tcatttaccaggctctgactcagaaccactttgacattatcaagaggatcattagctgggttttacagtttatcagggaa
aacatttctgcctggatcagacagcaaggaggatgggagggcattttccgcagcgtgtcaagatggcgtactgtgtcgtg
catcgctgcgatggcattcattgtagctgttgtttactggagaagaacgcgctaa
© 1998-2023Legal notice