Dataset for CDS BAX-like of Organism Canis lupus familiaris

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|F1PAN9_BAX-01 BCL2-associated X gene OS=[Eukaryota] Canis lupus familiaris GN=BAX (length=543 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaagatcgagcagggcgaatggggggagagacacctgagctgcccttggagcaggtgccccaggatg
catccaccaagaagctgagcgaatgtctcaagcgcatcggagatgaactggacagtaacatggagttgcagaggatgatc
gcagctgtggacacagactctccccgtgaggtcttcttccgagtggcagctgagatgttttctgatggcaacttcaactg
gggccgggttgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgagctgatca
ggaccatcatgggctggacactggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggtgagc
ctgcagtcccgaaggagccgaagaccacttgtttggaagcctacagggttgtgttggaggtag
>gnl|bcl2dbcds|F6PMP8_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Canis lupus familiaris GN=BAK1 (length=576 residues).
atggcatccgggcaaggcccagggcctcccaggcgggagtgtggagaggctgccccgtcttctacttctgaggagcaggt
agcccgggacaccgaggaggttttccgcagctatgttttttaccgccatcggcaggaacctagcagcaccatggggcagg
tgggtcggcagctcgctatcattggggacgacatcaaccagcgctatgactcggagttccaggccatgctgcagcaccta
cagccgacagcagagaatgcctatgagtacttcaccaagattgcctcgagcctatttgagagcggcatcaactggggccg
agtggtggctctcctgggctttggctaccgcctggccctgcatgtctaccaacgcggcctgaccggcttcctgggccagg
tgacccgcttcgtggccgacttcatgctgcatcattgcattgcccggtggatcgcgcagaggggtggctgggtggcagcc
ctgaacttgggaaacggccccatcctgaacgtgctgatagtgctgtctgtggttctgttgggccagtttgtggtacgaag
attcttcaaatcatga
>gnl|bcl2dbcds|F6PMP8_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Canis lupus familiaris GN=BAK1 (length=732 residues).
atggcatccgggcaaggcccagggcctcccaggcgggagtgtggagaggctgccccgtcttctacttctgaggagcaggt
agcccgggacaccgaggaggttttccgcagctatgttttttaccgccatcggcaggagcaggaggctgagggggcggctg
tgccagctgacccagaaatggtcaccttgcccctagaacctagcagcaccatggggcaggtgggtcggcagctcgctatc
attggggacgacatcaaccagcgctatgactcggagttccaggccatgctgcagcacctacagccgacagcagagaatgc
ctatgagtacttcaccaagattgcctcgagcctatttgagagcggcatcaactggggccgagtggtggctctcctgggct
ttggctaccgcctggccctgcatgtctaccaacgcggcctgaccggcttcctgggccaggtgacccgcttcgtggccgac
ttcatgctgcatcattgcattgcccggtggatcgcgcagaggggtggctgggtggcagccctgaacttgggaaacggccc
catcctgaacgtgctgatagtgctgtctgtggttctgttgggccagtttgtgcctacaggtctgggggaaaggagagaga
agttcatgattaagccaaatgcagggagcggatgcagatggagcccgctgaccagcccccaccctctgagtgtgtctgaa
aataaactgtaa
>gnl|bcl2dbcds|F6PMP8_BAK1-03 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Canis lupus familiaris GN=BAK1 (length=462 residues).
atggcatccgggcaaggcccagggcctcccaggcgggagtgtggagaggctgccccgtcttctacttctgaggagcaggt
agcccgggacaccgaggaggttttccgcagctatgttttttaccgccatcggcaggagcaggaggctgagggggcggctg
tgccagctgacccagaaatggtcaccttgcccctagaacctagcagcaccatggggcaggtgggtcggcagctcgctatc
attggggacgacatcaaccagcgctatgactcggagttccaggccatgctgcagcacctacagccgacagcagagaatgc
ctatgagtacttcaccaagattgcctcgaggccagcagcaacacccacagcctatttgagagcggcatcaactggggccg
agtggtggctctcctgggctttggctaccgcctggccctgcatgtctaccaacgcggcctga
>gnl|bcl2dbcds|Q52HB2_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Canis lupus familiaris GN=BAK1 (length=636 residues).
atggcatccgggcaaggcccagggcctcccaggcgggagtgtggagaggctgccccgtcttctacttctgaggagcaggt
agcccgggacaccgaggaggttttccgcagctatgttttttaccgccatcggcaggagcaggaggctgagggggcggctg
tgccagctgacccagaaatggtcaccttgcccctagaacctagcagcaccatggggcaggtgggtcggcagctcgctatc
attggggacgacatcaaccagcgctatgactcggagttccaggccatgctgcagcacctacagccgacagcagagaatgc
ctatgagtacttcaccaagattgcctcgagcctatttgagagcggcatcaactggggccgagtggtggctctcctgggct
ttggctaccgcctggccctgcatgtctaccaacgcggcctgaccggcttcctgggccaggtgacccgcttcgtggccgac
ttcatgctgcatcattgcattgcccggtggatcgcgcagaggggtggctgggtggcagccctgaacttgggaaacggccc
catcctgaacgtgctgatagtgctgtctgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
>gnl|bcl2dbcds|Q8HYU5_BAX-01 BCL2-associated X gene OS=[Eukaryota] Canis lupus familiaris GN=BAX (length=579 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaagatcgagcagggcgaatggggggagagacacctgagctgcccttggagcaggtgccccaggatg
catccaccaagaagctgagcgaatgtctcaagcgcatcggagatgaactggacagtaacatggagttgcagaggatgatc
gcagctgtggacacagactctccccgtgaggtcttcttccgagtggcagctgagatgttttctgatggcaacttcaactg
gggccgggttgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgagctgatca
ggaccatcatgggctggacactggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
ctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggctggagtgcttactgcgtcactcaccat
ctggaaaaagatgggctga
© 1998-2020Legal notice