Dataset for CDS BCL2L1 of organism Oncorhynchus tshawytscha

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C8J941_BCL2L1-      ---atgtcttacagtaacagg---gaactggtggtgttttttataagcta
A0A8C8GSY4_BCL2L1-      ---atgtcttacagtaacagg---gaactggtggtgttttttataagcta
A0A8C8GSY4_BCL2L1-      ---atgtcttacagtaacagg---gaactggtggtgttttttataagcta
A0A8C8FJG7_BCL2L1-      atgatgacttacaacaacaga---gaactggtggtatactatatcaccta
A0A8C8D057_BCL2L1-      ------atgtgtattaacctacctgaactggtggtatactatattaccta
A0A8C8D057_BCL2L1-      attatgacttacaacaacaga---gaactggtggtatactatattaccta
                                 *  *  ***      *********** *  * *** * ***

A0A8C8J941_BCL2L1-      tagactgtcccagaggaattattcatgttgtcaattggggctggagggtg
A0A8C8GSY4_BCL2L1-      taaactgtcccagagaaattatccatgttgtcagttggtgctggagggtg
A0A8C8GSY4_BCL2L1-      taaactgtcccagagaaattatccatgttgtcagttggtgctggagggtg
A0A8C8FJG7_BCL2L1-      taaactatcacagagggactaccctttcaaccacatggagctcacagaag
A0A8C8D057_BCL2L1-      taaactatcacagagagactaccccttcaaccacattgggctcacagaag
A0A8C8D057_BCL2L1-      taaactatcacagagagactaccccttcaaccacattgggctcacagaag
                        ** *** ** *****  * **  * *     **  * * ***    *  *

A0A8C8J941_BCL2L1-      caagtggacagactgagggagatgaggccatttcaaatgggtctgtgggg
A0A8C8GSY4_BCL2L1-      caagtggacggactgagggagatgaagccattgcaaatgggtctttgggg
A0A8C8GSY4_BCL2L1-      caagtggacggactgagggagatgaagccattgcaaatgggtctttgggg
A0A8C8FJG7_BCL2L1-      cccagaattgtac---------tgagg-gggggcaggtgga---aggggg
A0A8C8D057_BCL2L1-      ctcccagtcggactgagggggatgagg-ggggacaggtgga---aggggg
A0A8C8D057_BCL2L1-      ctcccagtcggactgagggggatgagg-ggggacaggtgga---aggggg
                        *          **         *** *      **  ***      ****

A0A8C8J941_BCL2L1-      aactactggaacagca----------------------gaagcaatttgg
A0A8C8GSY4_BCL2L1-      aacaacaggaacggca----------------------gaagcaatttgg
A0A8C8GSY4_BCL2L1-      aacaacaggaacggca----------------------gaagcaatttgg
A0A8C8FJG7_BCL2L1-      tgcggcagtcatgacatac------------gtcaacgggacgagtcccg
A0A8C8D057_BCL2L1-      ggcggcagtcacgacacaccccaatggcacagtgaacgggacgagtcctg
A0A8C8D057_BCL2L1-      ggcggcagtcacgacacaccccaatggcacagtgaacgggacgagtcctg
                          *  * *  *   **                      * *  * *   *

A0A8C8J941_BCL2L1-      cga---------------------agccctcatctccacaggg------g
A0A8C8GSY4_BCL2L1-      gta---------------------tgccttcctctgcacaagg------g
A0A8C8GSY4_BCL2L1-      gta---------------------tgccttcctctgcacaagg------g
A0A8C8FJG7_BCL2L1-      gtactcctccaccacggcagtcgcccccctcctcccctcggcggacagcg
A0A8C8D057_BCL2L1-      gga---ctccaccgcgacagtctccccccttgtcccctcagcggacaatg
A0A8C8D057_BCL2L1-      gga---ctccaccgcgacagtctccccccttgtcccctcagcggacaatg
                          *                       ** *  **  * *   *      *

A0A8C8J941_BCL2L1-      ggcatggagccagtgaaagcagcactacgggactcggtggatgagtttga
A0A8C8GSY4_BCL2L1-      ggaattgaggcggtgaaagcagcactacgggactcagtggatgagtttga
A0A8C8GSY4_BCL2L1-      ggaattgaggcggtgaaagcagcactacgggactcagtggatgagtttga
A0A8C8FJG7_BCL2L1-      ggcctggacgcagtgaaagaggcattgcgggactctgccaacgagtttga
A0A8C8D057_BCL2L1-      ggcctggacgcagtgaaagaggcattgcgggactctgccaacgagtttga
A0A8C8D057_BCL2L1-      ggcctggacgcagtgaaagaggcattgcgggactctgccaacgagtttga
                        **  * **  * *******  *** * ******** *   * ********

A0A8C8J941_BCL2L1-      gctgcgctacacccgcgccttcagtgacctctcctcccagctccacatca
A0A8C8GSY4_BCL2L1-      gctgcgttacacccgcgccttcagtgacctctgctcccagctccacatca
A0A8C8GSY4_BCL2L1-      gctgcgttacacccgcgccttcagtgacctctgctcccagctccacatca
A0A8C8FJG7_BCL2L1-      gctgcgttatgccagagctttcagtgacctgtcctcccagctacacatca
A0A8C8D057_BCL2L1-      gctgcgttatgccagagcgttcagtgacctgtcctcccagctacacatca
A0A8C8D057_BCL2L1-      gctgcgttatgccagagcgttcagtgacctgtcctcccagctacacatca
                        ****** **  ** * ** *********** * ********* *******

A0A8C8J941_BCL2L1-      cccctgccacagcctaccatagctttgagagtgtgatggacgaagtgttc
A0A8C8GSY4_BCL2L1-      cccctgccacagcctaccacagctttgagagcgtgatggacgaagtgttc
A0A8C8GSY4_BCL2L1-      cccctgccacagcctaccacagctttgagagcgtgatggacgaagtgttc
A0A8C8FJG7_BCL2L1-      cgccgtccacagcctatcagagctttgagaacgtgatggacgaggtgttc
A0A8C8D057_BCL2L1-      cgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttc
A0A8C8D057_BCL2L1-      cgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttc
                        * **  ********** ** ***** ****  ******** ** ** ***

A0A8C8J941_BCL2L1-      agggacggtgtcaactggggtcgcgtggtgggtctgtttgctttcggcgg
A0A8C8GSY4_BCL2L1-      agggacggggtcaactggggtcgcgtggtgggcctgtttgcttttggcgg
A0A8C8GSY4_BCL2L1-      agggacggggtcaactggggtcgcgtggtgggcctgtttgcttttggcgg
A0A8C8FJG7_BCL2L1-      cgggacggtgtcaactggggacgggtggtgggcctgtttgctttcggagg
A0A8C8D057_BCL2L1-      cgtgacggtgtgaactggggacgtgtggtgggcctgtttgccttcggagg
A0A8C8D057_BCL2L1-      cgtgacggtgtgaactggggacgtgtggtgggcctgtttgccttcggagg
                         * ***** ** ******** ** ******** ******** ** ** **

A0A8C8J941_BCL2L1-      ggccttgtgtgttgagtgtgttgagaaggatatgagcccactggtggcgc
A0A8C8GSY4_BCL2L1-      ggccctgtgtgttgagtgtgttgagaaggatatgagccacctggtgacgc
A0A8C8GSY4_BCL2L1-      ggccctgtgtgttgagtgtgttgagaaggatatgagccacctggtgacgc
A0A8C8FJG7_BCL2L1-      ggccctctgtgtagaatgtgtggacaaggagatgaaccccttggtgggta
A0A8C8D057_BCL2L1-      ggccctctgtgtagagtgtgtggagaaggagatgagcccactagtgggac
A0A8C8D057_BCL2L1-      ggccctctgtgtagagtgtgtggagaaggagatgagcccactagtgggac
                        **** * ***** ** ***** ** ***** **** **   * ***    

A0A8C8J941_BCL2L1-      gcatcgcagattggatgaccacatacctggataaccatatccagccctgg
A0A8C8GSY4_BCL2L1-      gcatcgcagactggatggccacctacctggacaaccatatccagccctgg
A0A8C8GSY4_BCL2L1-      gcatcgcagactggatggccacctacctggacaaccatatccagccctgg
A0A8C8FJG7_BCL2L1-      ggatcacagactggatgaccgtctatctggacaaccacatccagccctgg
A0A8C8D057_BCL2L1-      ggattgcagactggatgactgtatacctggacaaccacattcagccctgg
A0A8C8D057_BCL2L1-      ggattgcagactggatgactgtatacctggacaaccacattcagccctgg
                        * **  **** ****** *    ** ***** ***** ** *********

A0A8C8J941_BCL2L1-      atccagagccaaggaggatgggaccgttttgcagagatctttggcagaga
A0A8C8GSY4_BCL2L1-      atccagagccaaggaggatgggaccgttttgcggagatctttggcagaga
A0A8C8GSY4_BCL2L1-      atccagagccaaggaggatgggaccgttttgcggagatctttggcagaga
A0A8C8FJG7_BCL2L1-      atccagagccaaggaggatgggaccggtttgccgagatctttgggatgga
A0A8C8D057_BCL2L1-      atccagagccaaggaggatgggaccggtttgcagagatctttgggaagga
A0A8C8D057_BCL2L1-      atccagagccaaggaggatgggaccggtttgcagagatctttgggaagga
                        ************************** ***** *********** *  **

A0A8C8J941_BCL2L1-      tgctgctgcagacgttcgacggtcccaggagagcataattaaatggctgc
A0A8C8GSY4_BCL2L1-      tgcagctgcagacgtccgacggtcccaggagagcttaaaaaaatggctgc
A0A8C8GSY4_BCL2L1-      tgcagctgcagacgtccgacggtcccaggagagcttaaaaaaatggctgc
A0A8C8FJG7_BCL2L1-      cgctgcagccgagagcaggaagtctcaggagagctttaagaagtggtttc
A0A8C8D057_BCL2L1-      cgctgcagctgagagcaggaagtctcaggagagctttaagaagtggttgc
A0A8C8D057_BCL2L1-      cgctgcagctgagagcaggaagtctcaggagagctttaagaagtggttgc
                         ** ** ** **     *   *** ********* * *  ** *** * *

A0A8C8J941_BCL2L1-      tagttggggtgattctgctttcaggagtgctggtcggcactctcatcatg
A0A8C8GSY4_BCL2L1-      tagttggggtgatgctgctttcaggagtactggtcggcactctcatcatg
A0A8C8GSY4_BCL2L1-      tagttggggtgatgctgctttcaggagtactggtcggcactctcatcatg
A0A8C8FJG7_BCL2L1-      tggcggggatgaccctggtcacaggagtcgtcgtagggtcactcttcgct
A0A8C8D057_BCL2L1-      tggcggggatgacactggttacaggagtcatcgtagggtcactcattgct
A0A8C8D057_BCL2L1-      tggcggggatgacactggttacaggagtcatcgtagggtcactcattgct
                        * *  *** ***  *** *  *******  * ** **  * *** *    

A0A8C8J941_BCL2L1-      aagaaacgccaa--------------------------------------
A0A8C8GSY4_BCL2L1-      aagaaatgccag--------------------------------------
A0A8C8GSY4_BCL2L1-      aagaaatgccagtttgtgtgttaccctgtataccctaggaccaactacat
A0A8C8FJG7_BCL2L1-      cagaaacgcctg--------------------------------------
A0A8C8D057_BCL2L1-      cagaaacgcctg--------------------------------------
A0A8C8D057_BCL2L1-      cagaaacgcctg--------------------------------------
                         ***** ***                                        

A0A8C8J941_BCL2L1-      ----------------------tga
A0A8C8GSY4_BCL2L1-      ----------------------tga
A0A8C8GSY4_BCL2L1-      acattctttccaaatggacacttga
A0A8C8FJG7_BCL2L1-      ----------------------tga
A0A8C8D057_BCL2L1-      ----------------------tga
A0A8C8D057_BCL2L1-      ----------------------tga
                                              ***

© 1998-2023Legal notice