Dataset for CDS BCL2L1 of organism Oncorhynchus tshawytscha

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A8C8D057_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL2L1 (length=702 residues).
atgtgtattaacctacctgaactggtggtatactatattacctataaactatcacagagagactaccccttcaaccacat
tgggctcacagaagctcccagtcggactgagggggatgaggggggacaggtggaagggggggcggcagtcacgacacacc
ccaatggcacagtgaacgggacgagtcctgggactccaccgcgacagtctccccccttgtcccctcagcggacaatgggc
ctggacgcagtgaaagaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacctgtc
ctcccagctacacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgacggtgtga
actggggacgtgtggtgggcctgtttgccttcggaggggccctctgtgtagagtgtgtggagaaggagatgagcccacta
gtgggacggattgcagactggatgactgtatacctggacaaccacattcagccctggatccagagccaaggaggatggga
ccggtttgcagagatctttgggaaggacgctgcagctgagagcaggaagtctcaggagagctttaagaagtggttgctgg
cggggatgacactggttacaggagtcatcgtagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C8D057_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL2L1 (length=705 residues).
attatgacttacaacaacagagaactggtggtatactatattacctataaactatcacagagagactaccccttcaacca
cattgggctcacagaagctcccagtcggactgagggggatgaggggggacaggtggaagggggggcggcagtcacgacac
accccaatggcacagtgaacgggacgagtcctgggactccaccgcgacagtctccccccttgtcccctcagcggacaatg
ggcctggacgcagtgaaagaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacct
gtcctcccagctacacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgacggtg
tgaactggggacgtgtggtgggcctgtttgccttcggaggggccctctgtgtagagtgtgtggagaaggagatgagccca
ctagtgggacggattgcagactggatgactgtatacctggacaaccacattcagccctggatccagagccaaggaggatg
ggaccggtttgcagagatctttgggaaggacgctgcagctgagagcaggaagtctcaggagagctttaagaagtggttgc
tggcggggatgacactggttacaggagtcatcgtagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C8FJG7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL2L1 (length=687 residues).
atgatgacttacaacaacagagaactggtggtatactatatcacctataaactatcacagagggactaccctttcaacca
catggagctcacagaagcccagaattgtactgagggggggcaggtggaagggggtgcggcagtcatgacatacgtcaacg
ggacgagtcccggtactcctccaccacggcagtcgcccccctcctcccctcggcggacagcgggcctggacgcagtgaaa
gaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagctttcagtgacctgtcctcccagctacacat
cacgccgtccacagcctatcagagctttgagaacgtgatggacgaggtgttccgggacggtgtcaactggggacgggtgg
tgggcctgtttgctttcggaggggccctctgtgtagaatgtgtggacaaggagatgaaccccttggtgggtaggatcaca
gactggatgaccgtctatctggacaaccacatccagccctggatccagagccaaggaggatgggaccggtttgccgagat
ctttgggatggacgctgcagccgagagcaggaagtctcaggagagctttaagaagtggtttctggcggggatgaccctgg
tcacaggagtcgtcgtagggtcactcttcgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C8GSY4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctataaactgtcccagagaaattatccatgttgtcagtt
ggtgctggagggtgcaagtggacggactgagggagatgaagccattgcaaatgggtctttggggaacaacaggaacggca
gaagcaatttgggtatgccttcctctgcacaagggggaattgaggcggtgaaagcagcactacgggactcagtggatgag
tttgagctgcgttacacccgcgccttcagtgacctctgctcccagctccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggcctgtttgcttttggcggggccc
tgtgtgttgagtgtgttgagaaggatatgagccacctggtgacgcgcatcgcagactggatggccacctacctggacaac
catatccagccctggatccagagccaaggaggatgggaccgttttgcggagatctttggcagagatgcagctgcagacgt
ccgacggtcccaggagagcttaaaaaaatggctgctagttggggtgatgctgctttcaggagtactggtcggcactctca
tcatgaagaaatgccagtga
>gnl|bcl2dbcds|A0A8C8GSY4_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL2L1 (length=720 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctataaactgtcccagagaaattatccatgttgtcagtt
ggtgctggagggtgcaagtggacggactgagggagatgaagccattgcaaatgggtctttggggaacaacaggaacggca
gaagcaatttgggtatgccttcctctgcacaagggggaattgaggcggtgaaagcagcactacgggactcagtggatgag
tttgagctgcgttacacccgcgccttcagtgacctctgctcccagctccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggcctgtttgcttttggcggggccc
tgtgtgttgagtgtgttgagaaggatatgagccacctggtgacgcgcatcgcagactggatggccacctacctggacaac
catatccagccctggatccagagccaaggaggatgggaccgttttgcggagatctttggcagagatgcagctgcagacgt
ccgacggtcccaggagagcttaaaaaaatggctgctagttggggtgatgctgctttcaggagtactggtcggcactctca
tcatgaagaaatgccagtttgtgtgttaccctgtataccctaggaccaactacatacattctttccaaatggacacttga
>gnl|bcl2dbcds|A0A8C8J941_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctatagactgtcccagaggaattattcatgttgtcaatt
ggggctggagggtgcaagtggacagactgagggagatgaggccatttcaaatgggtctgtggggaactactggaacagca
gaagcaatttggcgaagccctcatctccacaggggggcatggagccagtgaaagcagcactacgggactcggtggatgag
tttgagctgcgctacacccgcgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccatagctt
tgagagtgtgatggacgaagtgttcagggacggtgtcaactggggtcgcgtggtgggtctgtttgctttcggcggggcct
tgtgtgttgagtgtgttgagaaggatatgagcccactggtggcgcgcatcgcagattggatgaccacatacctggataac
catatccagccctggatccagagccaaggaggatgggaccgttttgcagagatctttggcagagatgctgctgcagacgt
tcgacggtcccaggagagcataattaaatggctgctagttggggtgattctgctttcaggagtgctggtcggcactctca
tcatgaagaaacgccaatga
© 1998-2023Legal notice