Dataset for CDS BCL2L1 of organism Cebus imitator

[Download (right click)] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A2K5Q6R6_BCL2L1-01      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
A0A2K5Q6R6_BCL2L1-03      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-02      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
                                                                            

A0A2K5Q6R6_BCL2L1-01      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
A0A2K5Q6R6_BCL2L1-03      -----------------------------------atgtggaagagaaca
A0A2K5Q6R6_BCL2L1-02      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
                                                             ***************

A0A2K5Q6R6_BCL2L1-01      ggactgaggccccagaagggactgattcggagatggagacccccagtgcc
A0A2K5Q6R6_BCL2L1-03      ggactgaggccccagaagggactgattcggagatggagacccccagtgcc
A0A2K5Q6R6_BCL2L1-02      ggactgaggccccagaagggactgattcggagatggagacccccagtgcc
                          **************************************************

A0A2K5Q6R6_BCL2L1-01      atcaatggcaacccatcctggcacctggcggacagccccgcggtgaatgg
A0A2K5Q6R6_BCL2L1-03      atcaat--------------------------------------------
A0A2K5Q6R6_BCL2L1-02      atcaatggcaacccatcctggcacctggcggacagccccgcggtgaatgg
                          ******                                            

A0A2K5Q6R6_BCL2L1-01      agccacgggccacagcagcagtttggatgcccgggaggtgatccccatgg
A0A2K5Q6R6_BCL2L1-03      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-02      agccacgggccacagcagcagtttggatgcccgggaggtgatccccatgg
                                                                            

A0A2K5Q6R6_BCL2L1-01      cagcagtaaagcaagcactgagggaggcgggcgacgagtttgaactgcgg
A0A2K5Q6R6_BCL2L1-03      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-02      cagcagtaaagcaagcactgagggaggcgggcgacgagtttgaactgcgg
                                                                            

A0A2K5Q6R6_BCL2L1-01      taccggcgggcatttagtgacctgacatcccagctccacatcacccccgg
A0A2K5Q6R6_BCL2L1-03      --------------------------------gctccacatcacccccgg
A0A2K5Q6R6_BCL2L1-02      taccggcgggcatttagtgacctgacatcccagctccacatcacccccgg
                                                          ******************

A0A2K5Q6R6_BCL2L1-01      gacagcatatcaaagctttgaacaagtagtgaacgaactcttccgggatg
A0A2K5Q6R6_BCL2L1-03      gacagcatatcaaagctttgaacaagtagtgaacgaactcttccgggatg
A0A2K5Q6R6_BCL2L1-02      gacagcatatcaaagctttgaacaagtagtgaacgaactcttccgggatg
                          **************************************************

A0A2K5Q6R6_BCL2L1-01      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
A0A2K5Q6R6_BCL2L1-03      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
A0A2K5Q6R6_BCL2L1-02      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
                          **************************************************

A0A2K5Q6R6_BCL2L1-01      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
A0A2K5Q6R6_BCL2L1-03      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
A0A2K5Q6R6_BCL2L1-02      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
                          **************************************************

A0A2K5Q6R6_BCL2L1-01      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
A0A2K5Q6R6_BCL2L1-03      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
A0A2K5Q6R6_BCL2L1-02      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
                          **************************************************

A0A2K5Q6R6_BCL2L1-01      agaacggcggctgggacacttttgtggaactctatggaaacaatgcggca
A0A2K5Q6R6_BCL2L1-03      agaacggcggctgggacacttttgtggaactctatggaaacaatgcggca
A0A2K5Q6R6_BCL2L1-02      agaacggcggctgggacacttttgtggaactctatggaaacaatgcggca
                          **************************************************

A0A2K5Q6R6_BCL2L1-01      gccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacggg
A0A2K5Q6R6_BCL2L1-03      gccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacggg
A0A2K5Q6R6_BCL2L1-02      gccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacggg
                          **************************************************

A0A2K5Q6R6_BCL2L1-01      catgactgtggccggcgtggttctgctgggctcactctttagtcggaaat
A0A2K5Q6R6_BCL2L1-03      catgactgtggccggcgtggttctgctgggctcactctttagtcggaaat
A0A2K5Q6R6_BCL2L1-02      catgactgtggccggcgtggttctgctgggctcactctttagtcggaaat
                          **************************************************

A0A2K5Q6R6_BCL2L1-01      ga
A0A2K5Q6R6_BCL2L1-03      ga
A0A2K5Q6R6_BCL2L1-02      ga
                          **

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice