Dataset for CDS BCL-2-like of organism Amphilophus citrinellus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
A0A3Q0S9R1_BCL2L10      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      atgaacacgtgtactatgaggaattgtcgaatgggctcgtataaaaatgt

A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
A0A3Q0S9R1_BCL2L10      --------------------------------------------------
A0A3Q0R633_MCL1-01      ----------tctcttcctt------------------------------
A0A3Q0R633_MCL1-03      catggacctttttcttcctcaaaatggagtcgtggacggaacaatgcact

A0A3Q0S5Z7_BCL2-01      --------------------------------------atggcgaacgag
A0A3Q0RTF8_BCL2L1-      ------------------------------------atgtctcaaaacag
A0A3Q0S9R1_BCL2L10      --------------------------------------------------
A0A3Q0R633_MCL1-01      ------------------------------------ttacatccccagac
A0A3Q0R633_MCL1-03      atggatcggggaattcctctccgcaagatgccacaggtacacctaaagac

A0A3Q0S5Z7_BCL2-01      tataatcgcaatattgtgga--------aaagtatatctgc-----cata
A0A3Q0RTF8_BCL2L1-      agaactggtgcttttctacataacgtataaactatcccagagaaactatc
A0A3Q0S9R1_BCL2L10      ----atggt--ccctgggct----gtggaaagaaaccctggg----tttg
A0A3Q0R633_MCL1-01      tccaatggtaccccaaaacg----gccgaacaa---cctggg----ggtg
A0A3Q0R633_MCL1-03      tccaatggtaccccaaaacg----gccgaacaa---cctggg----ggtg
                             * *                    **       * *        * 

A0A3Q0S5Z7_BCL2-01      aactctccaaacggggatacgcgtgg-----ggatttgacggtgtccagg
A0A3Q0RTF8_BCL2L1-      ctctcaaccacatagtactcaacgagccttcgaacaggactgatgggggg
A0A3Q0S9R1_BCL2L10      g--------------------ctgag-----gactac--ctgtctctgtg
A0A3Q0R633_MCL1-01      gtatcaacaaacggatatgcaccaaa-----aaatatcacggacgacgtg
A0A3Q0R633_MCL1-03      gtatcaacaaacggatatgcaccaaa-----aaatatcacggacgacgtg
                                                               * *       *

A0A3Q0S5Z7_BCL2-01      atgaagatgctg-----ctaataacgggtcaataaatgaccctccaccga
A0A3Q0RTF8_BCL2L1-      gcagcagggttggatgaggaacagcgaatagatacacacgccaatgggac
A0A3Q0S9R1_BCL2L10      ctgcacaagtcc--------acatcaagtccctccacctcccagcgagtc
A0A3Q0R633_MCL1-01      gaagacggttcg--------ttgccgagcaccccggagtttcattcggat
A0A3Q0R633_MCL1-03      gaagacggttcg--------ttgccgagcaccccggagtttcattcggat
                                                *                *        

A0A3Q0S5Z7_BCL2-01      ctttggtccgccggtgc--cgagaacccagcaacgggcctgacggcgaga
A0A3Q0RTF8_BCL2L1-      ttttaatggcacaagtc--ccggtaccccgccagcgtccccgcagcggca
A0A3Q0S9R1_BCL2L10      agccgctgccatgagacgtctgg------gccaggatatt--gagcggca
A0A3Q0R633_MCL1-01      agtgaatccgacgaggcg-ctgg------agagggaaacgaaaagcctca
A0A3Q0R633_MCL1-03      agtgaatccgacgaggcg-ctgg------agagggaaacgaaaagcctca
                              *         *  *  *                     **   *

A0A3Q0S5Z7_BCL2-01      gcaacac-ccacctctgcagac--ggctcccacagtccgacccaca----
A0A3Q0RTF8_BCL2L1-      gcaacag-ccgccatcaacaac-------gaacct---------------
A0A3Q0S9R1_BCL2L10      gcaccaggctcgctttgacaaccttgctcagaccttcc------------
A0A3Q0R633_MCL1-01      ttactag--tttctttagagactttact-ggactttctcaacgacgatgg
A0A3Q0R633_MCL1-03      ttactag--tttctttagagactttact-ggactttctcaacgacgatgg
                          *  *      *       **         **                 

A0A3Q0S5Z7_BCL2-01      --------cgcagacatccacagagtcctgcgagaggctggagatgaact
A0A3Q0RTF8_BCL2L1-      --------cgacgcagtgaaggaggcgctccgggacacagccaacgagtt
A0A3Q0S9R1_BCL2L10      --------tgaggcatt----------------------gcgggc-----
A0A3Q0R633_MCL1-01      aaagaaagcgaagcactaaaaacaatgaaaagagttgtggcggacgtatt
A0A3Q0R633_MCL1-03      aaagaaagcgaagcactaaaaacaatgaaaagagttgtggcggacgtatt
                                 *  *   *                      *          

A0A3Q0S5Z7_BCL2-01      tgaaagactgtaccagccgga---cttcacggagatgtcgcggcagctgc
A0A3Q0RTF8_BCL2L1-      cg---agctgcgatacgctcgtgccttcaacgatctgcacagccagctgc
A0A3Q0S9R1_BCL2L10      -----cggatcactgctctag------------------cctcaggaagg
A0A3Q0R633_MCL1-01      agaaaagcaccgatacgcata------------------caacggaatgg
A0A3Q0R633_MCL1-03      agaaaagcaccgatacgcata------------------caacggaatgg
                                         *                              * 

A0A3Q0S5Z7_BCL2-01      atctcacctccgccacggcgcagaggagattcgccgaggtga--------
A0A3Q0RTF8_BCL2L1-      acatcacgccggccacggcctaccaaagcttcgagaatgtga--------
A0A3Q0S9R1_BCL2L10      tga------------tgg---aggagctggtgggagacg-gacacttgaa
A0A3Q0R633_MCL1-01      tcaacaaattgtcattgg---atgaaagaggggaggacgtgacatttg--
A0A3Q0R633_MCL1-03      tcaacaaattgtcattgg---atgaaagaggggaggacgtgacatttg--
                                        **   *          *   * * **        

A0A3Q0S5Z7_BCL2-01      -tagacgaac------------tgttccgggacgg---agtgaactgggg
A0A3Q0RTF8_BCL2L1-      -tggacgagg------------tgttccgggatgg---cgtcaactgggg
A0A3Q0S9R1_BCL2L10      ctgggggagg--gttgtttccctttttg----------cttttactgggg
A0A3Q0R633_MCL1-01      -tgagcgcggtagccaagagcctgtttgcagacaaaaccaccaactgggg
A0A3Q0R633_MCL1-03      -tgagcgcggtagccaagagcctgtttgcagacaaaaccaccaactgggg
                         *    *               * **                 *******

A0A3Q0S5Z7_BCL2-01      ccggattattgctttcttcgagtttgggggcacggtgtgc-----gtgga
A0A3Q0RTF8_BCL2L1-      ccgcatcgtagggcttttcgcgttcggcggggcactgtgt-----gtcga
A0A3Q0S9R1_BCL2L10      ------tgctagccagaaagaggctggagcag----aagccagggctgga
A0A3Q0R633_MCL1-01      tcgtattgccagtctgatggcctttggggcagtggtgtgtcagcgcttga
A0A3Q0R633_MCL1-03      tcgtattgccagtctgatggcctttggggcagtggtgtgtcagcgcttga
                                           *     ** *         *       * **

A0A3Q0S5Z7_BCL2-01      gtgcgcttccaacgagggg-------atgacatcgcaggtggacaacatc
A0A3Q0RTF8_BCL2L1-      gtgtgtcgagaaggag----------atgagccccctggtgggcaggatc
A0A3Q0S9R1_BCL2L10      ccctgggcaacagcaggaactgggacaggagcccataagctgcagggagc
A0A3Q0R633_MCL1-01      a---ggaaaaaggcagggac-----------------aattgtgtggagc
A0A3Q0R633_MCL1-03      a---ggaaaaaggcagggac-----------------aattgtgtggagc
                            *         **                         *     * *

A0A3Q0S5Z7_BCL2-01      --gcag---agtggatgacggagtatttaaatggacctcttaacagctgg
A0A3Q0RTF8_BCL2L1-      --gtag---agtggatgacagtctacctagacaaccacattcagccctgg
A0A3Q0S9R1_BCL2L10      tggcag---agaccatagctgattacctgggggaagagaagaaagactgg
A0A3Q0R633_MCL1-01      tggtgagccaggagatttccacatacctgctgtctgaccaacgagactgg
A0A3Q0R633_MCL1-03      tggtgagccaggagatttccacatacctgctgtctgaccaacgagactgg
                          *      **   **  *    **  *                  ****

A0A3Q0S5Z7_BCL2-01      atacaagataacgggggatgggatgcatttgtggagctgt----------
A0A3Q0RTF8_BCL2L1-      atccagagccaaggaggatgggagcgctttgctgaaatctttgggcagga
A0A3Q0S9R1_BCL2L10      ctcttggacaatgatggatgggagggtttctgtaagtactcc--------
A0A3Q0R633_MCL1-01      ctggttaaaaacaatgcatgggatggatttgtggagtttttt--------
A0A3Q0R633_MCL1-03      ctggttaaaaacaatgcatgggatggatttgtggagtttttt--------
                         *        *    * ******    **     *    *          

A0A3Q0S5Z7_BCL2-01      ----atggcagacagagggagtccgtcttcagttgctcctggccctccat
A0A3Q0RTF8_BCL2L1-      cgcggcggctgaaagccggaggtc-----------tcaggagagcttcaa
A0A3Q0S9R1_BCL2L10      cgcagtgccagagaggtgag---------------ccaggactcttccat
A0A3Q0R633_MCL1-01      cgt-gtagcaga-----------------------ccccgagtcaacagt
A0A3Q0R633_MCL1-03      cgt-gtagcaga-----------------------ccccgagtcaacagt
                                * **                                      

A0A3Q0S5Z7_BCL2-01      caaga---cagttttcggcttggctgcac---------tcggagcggcca
A0A3Q0RTF8_BCL2L1-      gaagtggctgcttgtgggcatgacggtggtgaccggcgtcgtggcaggtg
A0A3Q0S9R1_BCL2L10      gaagaccgcgct------gtttgctg---ctgctggcgtcggcctggccg
A0A3Q0R633_MCL1-01      gaggaacacactcatggcctttgctggatttgctggtattgg---ggcaa
A0A3Q0R633_MCL1-03      gaggaacacactcatggcctttgctggatttgctggtattgg---ggcaa
                         * *       *        *  * *            * *     *   

A0A3Q0S5Z7_BCL2-01      gcctcaccatcggagcatatcttacacaaaagtga
A0A3Q0RTF8_BCL2L1-      cactcatcgcg---------caaaaacgcctgtga
A0A3Q0S9R1_BCL2L10      ggcttactttc---------cttttggtgcgctag
A0A3Q0R633_MCL1-01      cactggc---c---------ctgttgatcaggtga
A0A3Q0R633_MCL1-03      cactggc---c---------ctgttgatcaggtga
                          **                *           *  

© 1998-2020Legal notice