Dataset for CDS BCL-2-like of organism Ursus maritimus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A452U285_BCL2A1-      atgcacacagaaattccaccggcctccgcgcgtcccatgag-tcaccgcc
A0A452U285_BCL2A1-      atgcacacagaaattccaccggcctccgcgcgtcccatgag-tcaccgcc
A0A452T603_BCL2-01      atg--------------------------gcgcacgctgggagaacaggg
A0A384D3U1_BCL2L1-      at------------------------------------g---tctcag--
A0A384DPS8_BCL2L2-      atg--------------------------gcgaccccag---cctcagcc
A0A384DPS8_BCL2L2-      atg--------------------------gcgaccccag---cctcagcc
A0A384DPS8_BCL2L2-      atg--------------------------gcgaccccag---cctcagcc
                        **                                    *      * *  

A0A452U285_BCL2A1-      ccagccccgccggcgctcgcctcatttggccnnnnnnnnnnnnnnnnnnn
A0A452U285_BCL2A1-      ccagccccgccggcgctcgcctcatttggccnnnnnnnnnnnnnnnnnnn
A0A452T603_BCL2-01      tatgataaccgggagatag-------------------------------
A0A384D3U1_BCL2L1-      ---agcaaccgggagctgg-------------------------------
A0A384DPS8_BCL2L2-      ccagacacacgggctctag-------------------------------
A0A384DPS8_BCL2L2-      ccagacacacgggctctag-------------------------------
A0A384DPS8_BCL2L2-      ccagacacacgggctctag-------------------------------
                                 * **   * *                               

A0A452U285_BCL2A1-      nnnnnnnnnnggggcgggtggaagatgacagactgcgagttcgggtacac
A0A452U285_BCL2A1-      nnnnnnnnnnggggcgggtggaagatgacagactgcgagttcgggtacac
A0A452T603_BCL2-01      -------------------------tgatgaagtaca---tccactataa
A0A384D3U1_BCL2L1-      -------------------------tggttgactttc---tctcctacaa
A0A384DPS8_BCL2L2-      -------------------------tggcagactttg---taggctataa
A0A384DPS8_BCL2L2-      -------------------------tggcagactttg---taggctataa
A0A384DPS8_BCL2L2-      -------------------------tggcagactttg---taggctataa
                                                 **    * *      *    ** * 

A0A452U285_BCL2A1-      cctgacgctggcccaggactac---------------------gtgaagc
A0A452U285_BCL2A1-      cctgacgctggcccaggactac---------------------gtgaagc
A0A452T603_BCL2-01      gctgtcgcaga---ggggctac----------------------------
A0A384D3U1_BCL2L1-      gctttcccaga---aaggatacagctggagtcagtttagtgatgtggaag
A0A384DPS8_BCL2L2-      gctgaggcaga---aaggttat-------------------gtgtg----
A0A384DPS8_BCL2L2-      gctgaggcaga---aaggttat-------------------gtgtg----
A0A384DPS8_BCL2L2-      gctgaggcaga---aaggttat-------------------gtgtg----
                         **    * *      *  **                             

A0A452U285_BCL2A1-      acgtcc---------------------------------tgcagatccc-
A0A452U285_BCL2A1-      acgtcc---------------------------------tgcagatccc-
A0A452T603_BCL2-01      --------------------------------------------------
A0A384D3U1_BCL2L1-      agaacagaactgaggccccagaaggaactgaatcagagatggagaccccc
A0A384DPS8_BCL2L2-      ---------------------------------------tggag------
A0A384DPS8_BCL2L2-      ---------------------------------------tggag------
A0A384DPS8_BCL2L2-      ---------------------------------------tggag------

A0A452U285_BCL2A1-      -------------gcagccgggctcagccccgagcag-------------
A0A452U285_BCL2A1-      -------------gcagccgggctcagccccgagcag-------------
A0A452T603_BCL2-01      -------------------------gaccccgtg----------------
A0A384D3U1_BCL2L1-      agtgccatcaatggcaacccatcctggcacttggcggacagccctgcggt
A0A384DPS8_BCL2L2-      -----------------------ctggccctggg----------------
A0A384DPS8_BCL2L2-      -----------------------ctggccctggg----------------
A0A384DPS8_BCL2L2-      -----------------------ctggccctggg----------------
                                                   * *   *                

A0A452U285_BCL2A1-      ------------------------------ggcgtcccaggtgctgcggg
A0A452U285_BCL2A1-      ------------------------------ggcgtcccaggtgctgcggg
A0A452T603_BCL2-01      ------------------------------------------------cc
A0A384D3U1_BCL2L1-      gaatggagccactggccacagcagcagcttggatgcccgggaggtgatcc
A0A384DPS8_BCL2L2-      ------------------------------gagggcccagcagctgaccc
A0A384DPS8_BCL2L2-      ------------------------------gagggcccagcagctgaccc
A0A384DPS8_BCL2L2-      ------------------------------gagggcccagcagctgaccc

A0A452U285_BCL2A1-      ac---------gtggcctcctccgtgcagggggaggtggaaaagaacttg
A0A452U285_BCL2A1-      ac---------gtggcctcctccgtgcagggggaggtggaaaagaacttg
A0A452T603_BCL2-01      ac----ctgtggtccacctgaccctgc--gccaggccggcgatgacttct
A0A384D3U1_BCL2L1-      ccatggcagcagtgaagcaagcgctga--gggaggccggggatgagttcg
A0A384DPS8_BCL2L2-      ac----------tgcaccaagccatgc--gggcagctggagatgagtttg
A0A384DPS8_BCL2L2-      ac----------tgcaccaagccatgc--gggcagctggagatgagtttg
A0A384DPS8_BCL2L2-      ac----------tgcaccaagccatgc--gggcagctggagatgagtttg
                         *          *        *  **   *    *  **  * **  *  

A0A452U285_BCL2A1-      aaacca--tgcctggacagtttcgatgtggtgtccgtc------------
A0A452U285_BCL2A1-      aaacca--tgcctggacagtttcgatgtggtgtccgtc------------
A0A452T603_BCL2-01      cccgtcgctaccgccgcgacttcgcggagatgtccagccagctgcacctg
A0A384D3U1_BCL2L1-      aactgaggtaccggcgggcattcagcgacctgacatcccagcttcacatc
A0A384DPS8_BCL2L2-      agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtg
A0A384DPS8_BCL2L2-      agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtg
A0A384DPS8_BCL2L2-      agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtg
                                * **        ***   *   ** *   *            

A0A452U285_BCL2A1-      ------gactccgccagaaccatattcaatcaggtcatggaaaaggaatt
A0A452U285_BCL2A1-      ------gactccgccagaaccatattcaatcaggtcatggaaaaggaatt
A0A452T603_BCL2-01      acacccttcaccgcaaggggacgctttgccacggtggtggaggagctctt
A0A384D3U1_BCL2L1-      accccagggacagcgtatcagagctttgagcaggtagtgaatgaactctt
A0A384DPS8_BCL2L2-      accccaggctcagcccagcaacgcttcacccaggtctctgacgaactctt
A0A384DPS8_BCL2L2-      accccaggctcagcccagcaacgcttcacccaggtctctgacgaactctt
A0A384DPS8_BCL2L2-      accccaggctcagcccagcaacgcttcacccaggtctctgacgaactctt
                                  * **          **      ***     *  *    **

A0A452U285_BCL2A1-      tgaagacggcatcattaactggggaagaattgtgaccatatttgcgttcg
A0A452U285_BCL2A1-      tgaagacggcatcattaactggggaagaattgtgaccatatttgcgttcg
A0A452T603_BCL2-01      cagggatggggtg---aactgggggaggattgtggccttctttgagttcg
A0A384D3U1_BCL2L1-      ccgggatggggtg---aactggggtcgcattgtggcctttttctccttcg
A0A384DPS8_BCL2L2-      ccaagggggcccc---aactggggccgcctggtggccttctttgtctttg
A0A384DPS8_BCL2L2-      ccaagggggcccc---aactggggccgcctggtggccttctttgtctttg
A0A384DPS8_BCL2L2-      ccaagggggcccc---aactggggccgcctggtggccttctttgtctttg
                            *  **       ********  *  * *** ** * **    ** *

A0A452U285_BCL2A1-      aagggattct---caccaagaaactcctccaggagcgaatctccccggat
A0A452U285_BCL2A1-      aagggattct---caccaagaaactcctccaggagcgaatctccccggat
A0A452T603_BCL2-01      gtggggtcatgtgtgtggagagcgtcaaccggga-------------gat
A0A384D3U1_BCL2L1-      gtggggcattgtgcgtggagagcgtagacaagga-------------gat
A0A384DPS8_BCL2L2-      gagccgcactgtgtgctgagagtgtcaacaaaga-------------gat
A0A384DPS8_BCL2L2-      gagccgcactgtgtgctgagagtgtcaacaaaga-------------gat
A0A384DPS8_BCL2L2-      gagccgcactgtgtgctgagagtgtcaacaaaga-------------gat
                          *      *        ***   *   *   **             ***

A0A452U285_BCL2A1-      gtggacgcttctagg----atttcttacttcgtggcggagttcatcacga
A0A452U285_BCL2A1-      gtggacgcttctagg----atttcttacttcgtggcggagttcatcacga
A0A452T603_BCL2-01      gtcgcccctggtggacaacattgccctgtggatgactgagtacctgaacc
A0A384D3U1_BCL2L1-      gcaggtattggtgagtcggatcgcaacttggatggccacttacctgaacg
A0A384DPS8_BCL2L2-      ggagccacttgtgggacaagtgcaagagtggatggtggcctacctggaga
A0A384DPS8_BCL2L2-      ggagccacttgtgggacaagtgcaagagtggatggtggcctacctggaga
A0A384DPS8_BCL2L2-      ggagccacttgtgggacaagtgcaagagtggatggtggcctacctggaga
                        *  *    *  *        *       *   **      * * *     

A0A452U285_BCL2A1-      caaacatgagagagtggataaggcagaacggaggctggtccctcctcccg
A0A452U285_BCL2A1-      caaacatgagagagtggataaggcagaacggaggctggg-----------
A0A452T603_BCL2-01      ggcacctgcacacctggatccaggacaacggaggctgggt-------agg
A0A384D3U1_BCL2L1-      accacctagagccttggatccaggagaacggcggctgggac------act
A0A384DPS8_BCL2L2-      cacggctggctgactggatccacagcagtgggggctgggcg------gag
A0A384DPS8_BCL2L2-      cacggctggctgactggatccacagcagtgggggctgggagctggaagcg
A0A384DPS8_BCL2L2-      cacggctggctgactggatccacagcagtgggggctgggagctggaagcg
                              *       *****       *  ** ******            

A0A452U285_BCL2A1-      ccctctgccagtgtgaagggctgcaagcggagggc---------------
A0A452U285_BCL2A1-      -aagatggctttgtaaagaagttcgaacccaagtctggctggctgac---
A0A452T603_BCL2-01      tgcacg----tccgcttgaa---------------tgtgcgtctg-----
A0A384D3U1_BCL2L1-      ttcgtggaactctacgggaa---caatgcagcggctgaaagccggaag--
A0A384DPS8_BCL2L2-      ttcacagctctatacgggga---------------cggggccctggagga
A0A384DPS8_BCL2L2-      atcaaagctcgagtcagggagatggaggaagaagctgagaagctaaagga
A0A384DPS8_BCL2L2-      atcaaagctcgagtcagggagatggaggaagaagctgagaagctaaagga

A0A452U285_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A384DPS8_BCL2L2-      ggcgcgg-------------------------------------------
A0A384DPS8_BCL2L2-      gctacagaacgaggtagagaaacagatgaatatgagtccacctccaggca
A0A384DPS8_BCL2L2-      gctacagaacgaggtagagaaacagatgaatatgagtccacctccaggca

A0A452U285_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A384DPS8_BCL2L2-      ------------------cgtctgcgggaggggaactg------------
A0A384DPS8_BCL2L2-      atgctggcccagtgatcatgtctattgaagagaagatggaggctgatgcc
A0A384DPS8_BCL2L2-      atgctggcccagtgatcatgtctattgaagagaagatggaggctgatgcc

A0A452U285_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      cgttccatctatgttggcaacgtggactatggtgcaacagcagaagagct
A0A384DPS8_BCL2L2-      cgttccatctatgttggcaacgtggactatggtgcaacagcagaagagct

A0A452U285_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      ggaagcacactttcatggctgtggttcagtcaatcgtgttaccatactct
A0A384DPS8_BCL2L2-      ggaagcacactttcatggctgtggttcagtcaatcgtgttaccatactct

A0A452U285_BCL2A1-      ----------------cc--------------------------------
A0A452U285_BCL2A1-      --------------tttt--------------------------------
A0A452T603_BCL2-01      --------------ggct--------------------------------
A0A384D3U1_BCL2L1-      --------------ggcc--------------------------------
A0A384DPS8_BCL2L2-      --------------ggcc--------------------------------
A0A384DPS8_BCL2L2-      gtgacaaatttagtggccatcctaaagggtttgcatatatagagttctca
A0A384DPS8_BCL2L2-      gtgacaaatttagtggccatcctaaagggtttgcatatatagagttctca

A0A452U285_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452T603_BCL2-01      ----------------gcacgtttcaaatctgagg---------------
A0A384D3U1_BCL2L1-      ---------------aggagcgcttcaacc--------------------
A0A384DPS8_BCL2L2-      ---------tcagtgaggac------------------------------
A0A384DPS8_BCL2L2-      gataaagagtcagtgaggacttccttggccttagatgagtccctgtttag
A0A384DPS8_BCL2L2-      gataaagagtcagtgaggacttccttggccttagatgagtccctgtttag

A0A452U285_BCL2A1-      --------------------------------------------------
A0A452U285_BCL2A1-      --------------------------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
A0A384D3U1_BCL2L1-      ---------------gctggttc---------------------------
A0A384DPS8_BCL2L2-      ---------------agtg-------------------------------
A0A384DPS8_BCL2L2-      aggaagacaaatcaaggtgatcccaaaacgaaccaacagaccaggcatca
A0A384DPS8_BCL2L2-      aggaagacaaatcaaggtgatcccaaaacgaaccaacagaccaggcatca

A0A452U285_BCL2A1-      ------ccggcagg---------------------tctgagagg------
A0A452U285_BCL2A1-      ------ctggaagt---------------------tatg-ggga------
A0A452T603_BCL2-01      ------ctgagaat--------------------ccgtggttgg------
A0A384D3U1_BCL2L1-      ------ctgacagg---------------catgactgtggctgg------
A0A384DPS8_BCL2L2-      ------ctgacagggg------------------ccgtggc---------
A0A384DPS8_BCL2L2-      gcacaacagaccggggtttcccacgagcccgataccgtgcccggaccacc
A0A384DPS8_BCL2L2-      gcacaacagaccggggtttcccacgagcccgataccgtgcccggaccacc
                              * *                            **           

A0A452U285_BCL2A1-      ----------------------------------------------agag
A0A452U285_BCL2A1-      ----------------------------------------------agat
A0A452T603_BCL2-01      ----------------------------agtgtgg--------gtgggct
A0A384D3U1_BCL2L1-      ------------------------------cgtggttctg----------
A0A384DPS8_BCL2L2-      ----------------------------------------actgggggcc
A0A384DPS8_BCL2L2-      aactacaacagttcccgctctcgattctacagtggttttaacagcaggcc
A0A384DPS8_BCL2L2-      aactacaacagttcccgctctcgattctacagtggttttaacagcaggcc

A0A452U285_BCL2A1-      ctgc----tgccaccttttcagctggctccagcgttcgtgagtag-----
A0A452U285_BCL2A1-      ctgtgaaatgttctctctcctgaag----caatactactga---------
A0A452T603_BCL2-01      cttgggccaagggcaaactgatgagcc--------agggaaataa-----
A0A384D3U1_BCL2L1-      ctgggctc----gc-tcttcag-------------tcggaaatga-----
A0A384DPS8_BCL2L2-      ctg---------gtaactgtaggggccttttttgctagcaagtga-----
A0A384DPS8_BCL2L2-      ccggggtc----gcgtctacaggggcc----gggctag--agcgacatca
A0A384DPS8_BCL2L2-      ccggggtc----gcgtctacaggggcc----gggctag--agcgacatca
                        *                                       *         

A0A452U285_BCL2A1-      ------------------
A0A452U285_BCL2A1-      ------------------
A0A452T603_BCL2-01      ------------------
A0A384D3U1_BCL2L1-      ------------------
A0A384DPS8_BCL2L2-      ------------------
A0A384DPS8_BCL2L2-      tggt------ttctgtag
A0A384DPS8_BCL2L2-      tggtattccccttactaa

© 1998-2023Legal notice