Dataset for CDS BOK of Organism Leptobrachium leishanense

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C5MG88_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Leptobrachium leishanense GN=BOK (length=645 residues).
atggagatgctacgccgctcatcggtttttgctgctgaagtttttgaggcctttgacagatcccccacagacaaggagtt
ggtttcgcagggaaaggccctctgcagggactatatccaggctcggcttctaagagctaacttgggatggagcaagccgg
agcacggcatatcttccacgtctgttggccgcatggctgaggtatcggacactttcctgaggctaggggatgagctggaa
tacatgaggccagccgtgtacagaaacatcgcccggcaactgaatatctccctcgcttctgagaccgtgctgtctgacgc
attcctggcggtggcagctgagatcttcacagcaggtatcacatgggggaaggtggtgtccttatatgcagtggcggccg
gtctagcagtggactgtgtgaagcagtctcagccggcctatgttctcaccattgtggactgcttgggggaatttgtaagg
aagaccctggtcacctggctgaagagaagaggaggatggacggatgtcaccaagtgtgttgtgacttctgatcctagttt
tcgatcccactggttggtgtccagtgcgtgcaactttggccatttcctgaaggcggtcatctttttcctattacgtgagc
ggtag
© 1998-2023Legal notice