Dataset for CDS MCL-1 of organism Electrophorus electricus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A4W4F1X6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Electrophorus electricus GN=MCL-1 (length=795 residues).
atgagtatgacgacgatgaagcgcacgacagcgatagggctgctgtgtaacggggctcaacacggagtgaaggacagctt
cgtcctcggggtgcgtcccacaatggcggcggaggacgagctggacggatgcgcggaggacacggatgggtggcccctca
aacccgccaggcacggtagaggcttgacactcgacacccggttccctcagtcttcaaacgcagacggctctctgcccact
tcccccgactcccaggagactctcccggacttcaggtctgatctggacgcggagactcgggagcttctcggatactttta
tcggacttacacaggacttccgcacaggagaactaaactcagcgctctgcccacgcttacgagggtcgtgggcgatgtga
tctgtaagcaccggattgcatataatggtatggtacagaagctgcagatggaggagcagagtgacgacctggaggttgtg
agcactgtggccaagagcatgttcagtgacggcatgactaactggggccgtgtggccagcctggtggcatttggcgcggt
gctgtgtgagagcctgaaggagagtgggagagatcactgtgtcgacaccgtagcccatcgcatctcatcctacctcacca
cctaccagcatgaatggctcctcaacaacaagtcctgggatggctttaaagaatttttccaagtggaggatccagagtct
gtggttcggaatgctttgatggcagtggcaggatttgctggtcttggggcagggctagctctcctgatgaggtga
>gnl|bcl2dbcds|A0A4W4H9I6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Electrophorus electricus GN=MCL-1 (length=693 residues).
atgattaatccacaagatatgtgttacagcaaggagagctccggaccaggaatgagacccgtgctatctttaggaatcac
ctctgacaaaagggtcattggcgaaggctcgttaccaaattcccccgagtcagactgcgaggagttgagcgtagttcgct
tcacggagggcagaactctggagaacgacacgcgagaaatcattaacgattcgcttctcgagcttacaggccgttctaat
tactacagtcgtcataggaaggtcgtaggaacaatgaagcgcgttgtaaacagcctggtggagaagcatgaacttgctta
taaaggtatgattgtgaaactgaatttggaggagagaggcgaagatatgcgtgtgattacgacagtagctaaggagatgt
tcagtgatggcaaaaccaactggggccgcattgccagtttgctggcctttgggtccatggtgtgcaaatatcataatgag
aagggccaaggccaccgtgtgcgtctggtgggagaagaaatctcctcttatctcctttctgacaaaagggactggctatt
gaaaaataaagcatgggatggttttgtggatttttttcatgtttcggatcctgagtcgaaactgaggaatgcgttaatga
ccattgctactgtggcagggattggggctggaattgccttttttagaagataa
© 1998-2020Legal notice