Dataset for CDS MCL-1 of organism Electrophorus electricus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W4F1X6_MCL1-01      atgagtatgacgacgatgaagcgcacgacagcgatagggctgctgtgtaa
A0A4W4H9I6_MCL1-01      atgatta-----------atccacaagata-------------tgtgtta
                        **** **           *  * ** ** *             ***** *

A0A4W4F1X6_MCL1-01      cggggctcaacacggagtgaaggacagcttcgtcctcggggtgcgtccca
A0A4W4H9I6_MCL1-01      cag---------------caaggagagctccggaccaggaatgagacccg
                        * *                ***** **** **  *  **  ** * *** 

A0A4W4F1X6_MCL1-01      caatggcggcggaggacgagctggacggatgcgcggaggacacggatggg
A0A4W4H9I6_MCL1-01      tgctatc-------------------------------------------
                           *  *                                           

A0A4W4F1X6_MCL1-01      tggcccctcaaacccgccaggcacggtagaggcttgacactcgacacccg
A0A4W4H9I6_MCL1-01      --------------------------tttaggaatcacctctgacaaaag
                                                  *  ***  * **    ****   *

A0A4W4F1X6_MCL1-01      gttccctcagtcttcaaacgcagacggctctctgcccacttccccc----
A0A4W4H9I6_MCL1-01      ggtcatt------------ggcgaaggctcgttaccaaattcccccgagt
                        * **  *            *  ** *****  * ** * *******    

A0A4W4F1X6_MCL1-01      --gactcccaggagac------------tctcccggacttcaggtctgat
A0A4W4H9I6_MCL1-01      cagactgcgaggagttgagcgtagttcgcttcacggagggcagaac---t
                          **** * *****                ** ****   ***  *   *

A0A4W4F1X6_MCL1-01      ctggacgcggagactcgggagcttctcg--gatacttttatcggacttac
A0A4W4H9I6_MCL1-01      ctggagaacgacacgcgagaaatcattaacgattcgcttctcgagctt--
                        *****    ** ** ** **  *  *    *** *  ** ***  ***  

A0A4W4F1X6_MCL1-01      acaggacttccgcacaggagaactaaactcagcgctctgcccacgcttac
A0A4W4H9I6_MCL1-01      acaggccgttc-----taattactacagtcgtca-------------tag
                        ***** * * *       *  **** * **  *              ** 

A0A4W4F1X6_MCL1-01      gagggtcgtgg------------gcgatgtgatctgt---------aagc
A0A4W4H9I6_MCL1-01      gaaggtcgtaggaacaatgaagcgcgttgtaaacagcctggtggagaagc
                        ** ****** *            *** *** * * *          ****

A0A4W4F1X6_MCL1-01      accggattgcatataatggtatggtacagaagctgcagatggaggagcag
A0A4W4H9I6_MCL1-01      atgaacttgcttataaaggtatgattgtgaaactgaatttggaggagaga
                        *     **** ***** ****** *   *** *** *  ********   

A0A4W4F1X6_MCL1-01      agtgacgacctggaggttgtgagcactgtggccaagagcatgttcagtga
A0A4W4H9I6_MCL1-01      ggcgaagatatgcgtgtgattacgacagtagctaaggagatgttcagtga
                         * ** **  **   **  * *  ** ** ** ***   ***********

A0A4W4F1X6_MCL1-01      cggcatgactaactggggccgtgtggccagcctggtggcatttggcgcgg
A0A4W4H9I6_MCL1-01      tggcaaaaccaactggggccgcattgccagtttgctggcctttgggtcca
                         ****  ** ***********  * *****  ** **** *****  *  

A0A4W4F1X6_MCL1-01      tgctgtgtgagagcctgaaggagagtgggagagatcactgtgtcgacacc
A0A4W4H9I6_MCL1-01      tggtgtgcaaatatcataatgagaagggccaaggccaccgtgtgcgtctg
                        ** ****  *    *  ** ****  **   **  *** ****       

A0A4W4F1X6_MCL1-01      gtagcccatcgcatctcatcctacctcaccacctaccagcatgaatggct
A0A4W4H9I6_MCL1-01      gtgggagaagaaatctcctcttatctcctttctgacaaaagggactggct
                        ** *   *    ***** ** ** ***    *  ** *    ** *****

A0A4W4F1X6_MCL1-01      cctcaacaacaagtcctgggatggctttaaagaatttttccaagtggagg
A0A4W4H9I6_MCL1-01      attgaaaaataaagcatgggatggttttgtggatttttttcatgtttcgg
                          * ** ** **  * ******** ***   ** ***** ** **   **

A0A4W4F1X6_MCL1-01      atccagagtctgtggttcggaatgctttgatggcagtggcaggatttgct
A0A4W4H9I6_MCL1-01      atcctgagtcgaaactgaggaatgcgttaatgaccattgctactgtggca
                        **** *****     *  ******* ** *** *  * **     * ** 

A0A4W4F1X6_MCL1-01      ggtcttggggcagggctagctctcctgatgaggtga
A0A4W4H9I6_MCL1-01      gggattggggctggaattgccttttttagaagataa
                        **  ******* **  * **  *  * *  ** * *

© 1998-2020Legal notice