Dataset for CDS BCL-2 of organism Rattus norvegicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


P49950_BCL2-01      atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatccat
Q7TSN8_BCL2-01      atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacat
                    ******************************************************** ***

P49950_BCL2-01      tataagctgtcacagaggggctacgagtgggatactggagatgaagactccgcgcccctg
Q7TSN8_BCL2-01      tataagctgtcacagaggggctacgagtgggatgctggagatgcggacgcggcgcccctg
                    ********************************* *********  *** * *********

P49950_BCL2-01      agggctgcccccacccctggcatcttctccttccagcctgagagcaaccgaacgcccgct
Q7TSN8_BCL2-01      ggggctgcccccacccctggcatcttctccttccagcctgagagcaacccaatgcccgct
                     ************************************************ ** *******

P49950_BCL2-01      gtgcaccgagacacggctgccaggacgtcgcctctacggccccttgtcgccaacgctggg
Q7TSN8_BCL2-01      gtgcaccgggacatggctgccaggacgtctcctctcaggcccctcgttgccaccgctggg
                    ******** **** *************** *****  ******* ** **** *******

P49950_BCL2-01      cctgcgctcagccctgtgccacctgtggtccacctgaccctccgccgggctggggatgac
Q7TSN8_BCL2-01      cctgcgctcagccctgtgccacctgtggtccatctgaccctccgccgggctggggatgac
                    ******************************** ***************************

P49950_BCL2-01      ttctctcgtcgctaccgtcgcgactttgcagagatgtccagtcagctgcacctgacgccc
Q7TSN8_BCL2-01      ttctctcgtcgctaccgtcgtgacttcgcagagatgtccagtcagctgcacctgacgccc
                    ******************** ***** *********************************

P49950_BCL2-01      ttcaccgcgaggggacgctttgccacggtggtggaggaactcttcagggatggggtgaac
Q7TSN8_BCL2-01      ttcaccgcgaggggacgctttgccacggtggtggaggaactcttcagggatggggtgaac
                    ************************************************************

P49950_BCL2-01      tgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggggagcgtcaac
Q7TSN8_BCL2-01      tgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
                    ************************************************* **********

P49950_BCL2-01      agggagatgtcacccctggtggacaacatcgctctgtggatgactgagtacctgaaccgg
Q7TSN8_BCL2-01      agggagatgtcacccctggtggacaacatcgccctgtggatgactgagtacctgaaccgg
                    ******************************** ***************************

P49950_BCL2-01      catctgcacacctggatccaggataacggaggctgggatgcctttgtggaactatatggc
Q7TSN8_BCL2-01      catctgcacacctggatccaggataacggaggctgggatgcctttgtggaactatatggc
                    ************************************************************

P49950_BCL2-01      cccagcatgcgacctctgtttgatttctcctggctgtctctgaagacgctgctcagcctg
Q7TSN8_BCL2-01      cccagcatgcgacctctgtttgatttctcctggctgtctctgaagaccctgctcagcctg
                    *********************************************** ************

P49950_BCL2-01      gccctggtgggggcctgcatcactctgggtgcatacctgggccacaagtga
Q7TSN8_BCL2-01      gccctggtcggggcctgcatcactctgggtgcatacctgggccacaagtga
                    ******** ******************************************

© 1998-2022Legal notice