Dataset for CDS BCL-2 of organism Rattus norvegicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q7TSN8_BCL2-01          atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaa
A0A8I6AJ02_BCL2-01      atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaa
P49950_BCL2-01          atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaa
                        **************************************************

Q7TSN8_BCL2-01          gtacatacattataagctgtcacagaggggctacgagtgggatgctggag
A0A8I6AJ02_BCL2-01      gtacatccattataagctgtcacagaggggctacgagtgggatactggag
P49950_BCL2-01          gtacatccattataagctgtcacagaggggctacgagtgggatactggag
                        ****** ************************************ ******

Q7TSN8_BCL2-01          atgcggacgcggcgcccctgggggctgcccccacccctggcatcttctcc
A0A8I6AJ02_BCL2-01      atgaagactccgcgcccctgagggctgcccccacccctggcatcttctcc
P49950_BCL2-01          atgaagactccgcgcccctgagggctgcccccacccctggcatcttctcc
                        ***  *** * ********* *****************************

Q7TSN8_BCL2-01          ttccagcctgagagcaacccaatgcccgctgtgcaccgggacatggctgc
A0A8I6AJ02_BCL2-01      ttccagcctgagagcaaccggacgcccgctgtgcaccgagacacggctgc
P49950_BCL2-01          ttccagcctgagagcaaccgaacgcccgctgtgcaccgagacacggctgc
                        *******************  * *************** **** ******

Q7TSN8_BCL2-01          caggacgtctcctctcaggcccctcgttgccaccgctgggcctgcgctca
A0A8I6AJ02_BCL2-01      caggacgtcgcctctacggccccttgtcgccaccgctgggcctgcgctca
P49950_BCL2-01          caggacgtcgcctctacggccccttgtcgccaacgctgggcctgcgctca
                        ********* *****  ******* ** **** *****************

Q7TSN8_BCL2-01          gccctgtgccacctgtggtccatctgaccctccgccgggctggggatgac
A0A8I6AJ02_BCL2-01      gccctgtgccacctgtggtccacctgaccctccgccgggctggggatgac
P49950_BCL2-01          gccctgtgccacctgtggtccacctgaccctccgccgggctggggatgac
                        ********************** ***************************

Q7TSN8_BCL2-01          ttctctcgtcgctaccgtcgtgacttcgcagagatgtccagtcagctgca
A0A8I6AJ02_BCL2-01      ttctctcgtcgctaccgtcgcgactttgcagagatgtccagtcagctgca
P49950_BCL2-01          ttctctcgtcgctaccgtcgcgactttgcagagatgtccagtcagctgca
                        ******************** ***** ***********************

Q7TSN8_BCL2-01          cctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
A0A8I6AJ02_BCL2-01      cctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
P49950_BCL2-01          cctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
                        **************************************************

Q7TSN8_BCL2-01          tcttcagggatggggtgaactgggggaggattgtggccttctttgagttc
A0A8I6AJ02_BCL2-01      tcttcagggatggggtgaactgggggaggattgtggccttctttgagttc
P49950_BCL2-01          tcttcagggatggggtgaactgggggaggattgtggccttctttgagttc
                        **************************************************

Q7TSN8_BCL2-01          ggtggggtcatgtgtgtggagagcgtcaacagggagatgtcacccctggt
A0A8I6AJ02_BCL2-01      ggtggggtcatgtgtgtggagagcgtcaacagggagatgtcacccctggt
P49950_BCL2-01          ggtggggtcatgtgtgtggggagcgtcaacagggagatgtcacccctggt
                        ******************* ******************************

Q7TSN8_BCL2-01          ggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcaca
A0A8I6AJ02_BCL2-01      ggacaacatcgctctgtggatgactgagtacctgaaccggcatctgcaca
P49950_BCL2-01          ggacaacatcgctctgtggatgactgagtacctgaaccggcatctgcaca
                        ************ *************************************

Q7TSN8_BCL2-01          cctggatccaggataacggaggctgggatgcctttgtggaactatatggc
A0A8I6AJ02_BCL2-01      cctggatccaggataacggaggctggg-----------------------
P49950_BCL2-01          cctggatccaggataacggaggctgggatgcctttgtggaactatatggc
                        ***************************                       

Q7TSN8_BCL2-01          cccagcatgcgacctctgtttgatttctcctggctgtctctgaagaccct
A0A8I6AJ02_BCL2-01      --------------------------------------------------
P49950_BCL2-01          cccagcatgcgacctctgtttgatttctcctggctgtctctgaagacgct
                                                                          

Q7TSN8_BCL2-01          gctcagcctggccctggtcggggcctgcatcactctgggtgcatacctgg
A0A8I6AJ02_BCL2-01      -----------------------------------taggtgcatgtctgg
P49950_BCL2-01          gctcagcctggccctggtgggggcctgcatcactctgggtgcatacctgg
                                                           * *******  ****

Q7TSN8_BCL2-01          gccacaagtga
A0A8I6AJ02_BCL2-01      t---tgaatga
P49950_BCL2-01          gccacaagtga
                              * ***

© 1998-2023Legal notice