Dataset for CDS BCL2L10 of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4X1T1Z2_BCL2L10      atggcggacgcgttcagggagcgcacagcccggcttctgaccgactacct
F1RZB9_BCL2L10-01       atggcggacgcgttcagggagcgcacagcccggcttctgaccgactacct
                        **************************************************

A0A4X1T1Z2_BCL2L10      ggagtactgcgcccgggagcccggcaccgccgcgcggcagccgtcctcgc
F1RZB9_BCL2L10-01       ggagtactgcgcccgggagcccggcaccgccgcgcggcagccgtcctcgc
                        **************************************************

A0A4X1T1Z2_BCL2L10      ccgaggccgcagtgctgcgttgcgtggctgcccagatacgggagtacaac
F1RZB9_BCL2L10-01       ccgaggccgcagtgctgcgttgcgtggctgcccagatacgggagtacaac
                        **************************************************

A0A4X1T1Z2_BCL2L10      gtgcgcaccttgtctgtctaccgcggcttccgctggaaccgtgtcgaatt
F1RZB9_BCL2L10-01       gtgcgcaccttgtctgtctaccgcggcttccgctggaaccgtgtcgaatt
                        **************************************************

A0A4X1T1Z2_BCL2L10      ggtggcctggatggcacagaaactactcgcaagcccacgtggccccaact
F1RZB9_BCL2L10-01       ggtggcctggatggcacagaaactactcgcaagcccacgtggccccaact
                        **************************************************

A0A4X1T1Z2_BCL2L10      ggtaccgcgtggcatcactcttgaccttcgcagggatgctgctggaaaga
F1RZB9_BCL2L10-01       ggtaccgcgtggcatcactcttgaccttcgcagggatgctgctggaaaga
                        **************************************************

A0A4X1T1Z2_BCL2L10      catcctcgg------------------------------------agcag
F1RZB9_BCL2L10-01       catcctcgggaggcctgtgggcggaagaagaaggagggcaacgttagcag
                        *********                                    *****

A0A4X1T1Z2_BCL2L10      ggactgccgactcctggtggctttgctgtgcgctcagctctcagggcagc
F1RZB9_BCL2L10-01       ggactgccgactcctggtggctttgctgtgcgctcagctctcagggcagc
                        **************************************************

A0A4X1T1Z2_BCL2L10      atcgcacctggctattggcgaacggcggctgggatggattttgtctcttc
F1RZB9_BCL2L10-01       atcgcacctggctattggcgaacggcggctgggatggattttgtctcttc
                        **************************************************

A0A4X1T1Z2_BCL2L10      ttccaaggctcattgcaacaaacttggacaagacacatggtctgggtttt
F1RZB9_BCL2L10-01       ttccaaggttcattgcaacaaacttggacaagacacatggtctgggtttt
                        ******** *****************************************

A0A4X1T1Z2_BCL2L10      tgtgtcatactgtacagcagtggtcttactctacttgtggagaaaattat
F1RZB9_BCL2L10-01       tgtgtcatactgtacagcagtggtcttactctacttgtggagaaaattat
                        **************************************************

A0A4X1T1Z2_BCL2L10      tgtga
F1RZB9_BCL2L10-01       tgtga
                        *****

© 1998-2020Legal notice