Dataset for CDS BCL2L10 of organism Sus scrofa

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A4X1T1Z2_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Sus scrofa GN=BCL2L10 (length=519 residues).
atggcggacgcgttcagggagcgcacagcccggcttctgaccgactacctggagtactgcgcccgggagcccggcaccgc
cgcgcggcagccgtcctcgcccgaggccgcagtgctgcgttgcgtggctgcccagatacgggagtacaacgtgcgcacct
tgtctgtctaccgcggcttccgctggaaccgtgtcgaattggtggcctggatggcacagaaactactcgcaagcccacgt
ggccccaactggtaccgcgtggcatcactcttgaccttcgcagggatgctgctggaaagacatcctcggagcagggactg
ccgactcctggtggctttgctgtgcgctcagctctcagggcagcatcgcacctggctattggcgaacggcggctgggatg
gattttgtctcttcttccaaggctcattgcaacaaacttggacaagacacatggtctgggtttttgtgtcatactgtaca
gcagtggtcttactctacttgtggagaaaattattgtga
>gnl|bcl2dbcds|F1RZB9_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Sus scrofa GN=BCL2L10 (length=555 residues).
atggcggacgcgttcagggagcgcacagcccggcttctgaccgactacctggagtactgcgcccgggagcccggcaccgc
cgcgcggcagccgtcctcgcccgaggccgcagtgctgcgttgcgtggctgcccagatacgggagtacaacgtgcgcacct
tgtctgtctaccgcggcttccgctggaaccgtgtcgaattggtggcctggatggcacagaaactactcgcaagcccacgt
ggccccaactggtaccgcgtggcatcactcttgaccttcgcagggatgctgctggaaagacatcctcgggaggcctgtgg
gcggaagaagaaggagggcaacgttagcagggactgccgactcctggtggctttgctgtgcgctcagctctcagggcagc
atcgcacctggctattggcgaacggcggctgggatggattttgtctcttcttccaaggttcattgcaacaaacttggaca
agacacatggtctgggtttttgtgtcatactgtacagcagtggtcttactctacttgtggagaaaattattgtga
© 1998-2022Legal notice