Dataset for CDS MCL-1 of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


C8YZ26_MCL1-01      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggc
B4DLY8_MCL1-01      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggc
B4E3L8_MCL1-01      atg---------------------------------------------------------
B4DG83_MCL1-01      atg---------------------------------------------------------
B4DU51_MCL1-01      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggc
Q07820_MCL1-04      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggc
                    ***                                                         

C8YZ26_MCL1-01      ttgggggccggcagcggcggcgccacccgcccgggagggcgactttt-------------
B4DLY8_MCL1-01      ttgggggccggcagcggcggcgccacccgcccgggagggcgacttttggctacggagaag
B4E3L8_MCL1-01      ------------------------------------------------------------
B4DG83_MCL1-01      ------------------------------------------------------------
B4DU51_MCL1-01      ttgggggccggcagcggcggcgccacccgcccgggagggcgacttttggctacggagatg
Q07820_MCL1-04      ttgggggccggcagcggcggcgccacccgcccgggagggcgactttt-------------
                                                                                

C8YZ26_MCL1-01      ------------------------------------------------------------
B4DLY8_MCL1-01      gaggcctcg--------------------gcccggcgagagatagggggaggggaggccg
B4E3L8_MCL1-01      gaagccccggccgctgacgccatcatgtcgcccgaagaggagctggacgggtacgagccg
B4DG83_MCL1-01      gaagccccggccgctgacgccatcatgtcgcccgaagaggagctggacgggtacgagccg
B4DU51_MCL1-01      gaagccccggccgctgacgccatcatgtcgcccgaagaggagctggacgggtacgagccg
Q07820_MCL1-04      ------------------------------------------------------------
                                                                                

C8YZ26_MCL1-01      ------------------------------------------------------------
B4DLY8_MCL1-01      gcgc----------------------------------------------ggtgattggc
B4E3L8_MCL1-01      gagcctctcgggaagcggccggctgtcctgccgctgctggagttggtcggggaatctggt
B4DG83_MCL1-01      gagcctctcgggaagcggccggctgtcctgccgctgctggagttggtcggggaatctggt
B4DU51_MCL1-01      gagcctctcgggaagcggccggctgtcctgccgctgctggagttggtcggggaatctggt
Q07820_MCL1-04      ------------------------------------------------------------
                                                                                

C8YZ26_MCL1-01      ------------------------------------------------------------
B4DLY8_MCL1-01      ggaagcgccggcgcaagc------cccccgtccaccctcacgccaga-------------
B4E3L8_MCL1-01      aataacaccagtacggacgggtcactaccctcgacgccgccgccagcagaggaggaggag
B4DG83_MCL1-01      aataacaccagtacggacgggtcactaccctcgacgccgccgccagcagaggaggaggag
B4DU51_MCL1-01      aataacaccagtacggacgggtcactacccttgacgccgccgccagcagaggaggaggag
Q07820_MCL1-04      ------------------------------------------------------------
                                                                                

C8YZ26_MCL1-01      -----------------------------------------------------ggccacc
B4DLY8_MCL1-01      --------------------------------ctcccgg-------agggtcgcgcggcc
B4E3L8_MCL1-01      gacgagttgtaccggcagtcgctggagattatctctcggtaccttcgggagcaggccacc
B4DG83_MCL1-01      gacgagttgtaccggcagtcgctggagattatctctcggtaccttcgggagcaggccacc
B4DU51_MCL1-01      gacgagttgtaccggcagtcgctggagattatctctcggtaccttcgggagcaggccacc
Q07820_MCL1-04      -----------------------------------------------------ggccacc
                                                                          **  **

C8YZ26_MCL1-01      ggcg-ccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctgga
B4DLY8_MCL1-01      gccgcccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctgga
B4E3L8_MCL1-01      ggcg-ccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctgga
B4DG83_MCL1-01      ggcg-ccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctgga
B4DU51_MCL1-01      ggcg-ccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctgga
Q07820_MCL1-04      ggcg-ccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctgga
                    * ** *******************************************************

C8YZ26_MCL1-01      gaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcat
B4DLY8_MCL1-01      gaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcat
B4E3L8_MCL1-01      gaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcat
B4DG83_MCL1-01      gaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcat
B4DU51_MCL1-01      gaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcat
Q07820_MCL1-04      gaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcat
                    ************************************************************

C8YZ26_MCL1-01      gcttcggagactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgat
B4DLY8_MCL1-01      gcttcggaaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgat
B4E3L8_MCL1-01      gcttcggaaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgat
B4DG83_MCL1-01      gcttcggaaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgat
B4DU51_MCL1-01      gcttcggaaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgat
Q07820_MCL1-04      gcttcggaaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgat
                    ******** ***************************************************

C8YZ26_MCL1-01      ccatgttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttcttttgg
B4DLY8_MCL1-01      ccatgttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttcttttgg
B4E3L8_MCL1-01      ccatgttttcagcgacagcgtaacaaactggggcaggattgtgactctcatttcttttgg
B4DG83_MCL1-01      ccatgttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttcttttgg
B4DU51_MCL1-01      ccatgttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttcttttgg
Q07820_MCL1-04      ccatgttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttcttttgg
                    **************** *******************************************

C8YZ26_MCL1-01      tgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagc
B4DLY8_MCL1-01      tgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagc
B4E3L8_MCL1-01      tgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagc
B4DG83_MCL1-01      tgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagc
B4DU51_MCL1-01      tgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagc
Q07820_MCL1-04      tgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagc
                    ************************************************************

C8YZ26_MCL1-01      agaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagagg
B4DLY8_MCL1-01      agaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagagg
B4E3L8_MCL1-01      agaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagagg
B4DG83_MCL1-01      agaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagagg
B4DU51_MCL1-01      agaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagagg
Q07820_MCL1-04      agaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagagg
                    ************************************************************

C8YZ26_MCL1-01      ctgggatgggtttgtggagttcttccaagtagaggacctagaaggtggcatcaggaatgt
B4DLY8_MCL1-01      ctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgt
B4E3L8_MCL1-01      ctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgt
B4DG83_MCL1-01      ctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgt
B4DU51_MCL1-01      ctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgt
Q07820_MCL1-04      ctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgt
                    *************************** ********************************

C8YZ26_MCL1-01      gctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaaaaagata
B4DLY8_MCL1-01      gctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagata
B4E3L8_MCL1-01      gctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagata
B4DG83_MCL1-01      gctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagata
B4DU51_MCL1-01      gctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagata
Q07820_MCL1-04      gctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagata
                    ***************************************************** ******

C8YZ26_MCL1-01      g
B4DLY8_MCL1-01      g
B4E3L8_MCL1-01      g
B4DG83_MCL1-01      g
B4DU51_MCL1-01      g
Q07820_MCL1-04      g
                    *

© 1998-2020Legal notice