Dataset for CDS MCL-1 of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


C8YZ26_MCL1-01      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggc
Q07820_MCL1-09      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggc
B4E3L8_MCL1-01      ------------------------------------------------------------
Q07820_MCL1-06      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggc
B4DU51_MCL1-01      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggc
B4DLY8_MCL1-01      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggc
B4DG83_MCL1-01      ------------------------------------------------------------
Q07820_MCL1-03      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggc
Q07820_MCL1-05      ------------------------------------------------------------
Q07820_MCL1-07      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggc
                                                                                

C8YZ26_MCL1-01      ttgggggccggcagcggcggcgccacccgcccgggagggcgactttt-------------
Q07820_MCL1-09      ttgggggccggcagcggcggcgccacccgcccgggagggcgacttttggctacggagaag
B4E3L8_MCL1-01      ------------------------------------------------------------
Q07820_MCL1-06      ttgggggccggcagcggcggcgccacccgcccgggagggcgacttttggc----------
B4DU51_MCL1-01      ttgggggccggcagcggcggcgccacccgcccgggagggcgacttttggctacggag---
B4DLY8_MCL1-01      ttgggggccggcagcggcggcgccacccgcccgggagggcgacttttggctacggagaag
B4DG83_MCL1-01      ------------------------------------------------------------
Q07820_MCL1-03      ttgggggccggcagcggcggcgccacccgcccgggagggcgacttttggctacggagaag
Q07820_MCL1-05      ------------------------------------------------------------
Q07820_MCL1-07      ttgggggccggcagcggcggcgccacccgcccgggagggcgacttttggctacggagaag
                                                                                

C8YZ26_MCL1-01      ------------------------------------------------------------
Q07820_MCL1-09      gaggcctcggcccggcgagagatagggggaggggaggccggcgcggtgattggcggaagc
B4E3L8_MCL1-01      ------------------------------------------------------------
Q07820_MCL1-06      ------------------------------------------------------------
B4DU51_MCL1-01      ------------------------------------------------------------
B4DLY8_MCL1-01      gaggcctcggcccggcgagagatagggggaggggaggccggcgcggtgattggcggaagc
B4DG83_MCL1-01      ------------------------------------------------------------
Q07820_MCL1-03      gaggcctcggcccggcgagagatagggggaggggaggccggcgcggtgattggcggaagc
Q07820_MCL1-05      ------------------------------------------------------------
Q07820_MCL1-07      gaggcctcggcccggcgagagatagggggaggggaggccggcgcggtgattggcggaagc
                                                                                

C8YZ26_MCL1-01      ------------------------------------------------------------
Q07820_MCL1-09      gccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
B4E3L8_MCL1-01      ------------------------------------------------------------
Q07820_MCL1-06      ------------------------------------------------------------
B4DU51_MCL1-01      ------------------------------------------------------------
B4DLY8_MCL1-01      gccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
B4DG83_MCL1-01      ------------------------------------------------------------
Q07820_MCL1-03      gccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
Q07820_MCL1-05      ------------------------------------------------------------
Q07820_MCL1-07      gccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
                                                                                

C8YZ26_MCL1-01      ------------------------------------------------------------
Q07820_MCL1-09      cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcg
B4E3L8_MCL1-01      ------------------------------------------------------------
Q07820_MCL1-06      ------------------------------------------------------------
B4DU51_MCL1-01      ------------------------------------------------------------
B4DLY8_MCL1-01      c-----------------------------------------------------------
B4DG83_MCL1-01      ------------------------------------------------------------
Q07820_MCL1-03      cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcg
Q07820_MCL1-05      ------------------------------------------------------------
Q07820_MCL1-07      cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcg
                                                                                

C8YZ26_MCL1-01      ------------------------------------------------------------
Q07820_MCL1-09      cccacccgccgcgcggcgccgcttgaggagatggaagccccggccgctgacgccatcatg
B4E3L8_MCL1-01      ------------------------------atggaagccccggccgctgacgccatcatg
Q07820_MCL1-06      ------------------------------------------------------------
B4DU51_MCL1-01      ------------------------------atggaagccccggccgctgacgccatcatg
B4DLY8_MCL1-01      ------------------------------------------------------------
B4DG83_MCL1-01      ------------------------------atggaagccccggccgctgacgccatcatg
Q07820_MCL1-03      cccacccgccgcgcggcgccgcttgaggagatggaagccccggccgctgacgccatcatg
Q07820_MCL1-05      ------------------------------------------------------------
Q07820_MCL1-07      cccacccgccgcgcggcgccgcttgaggagatggaagccccggccgctgacgccatcatg
                                                                                

C8YZ26_MCL1-01      ------------------------------------------------------------
Q07820_MCL1-09      tcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcggccggctgtc
B4E3L8_MCL1-01      tcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcggccggctgtc
Q07820_MCL1-06      ------------------------------------------------------------
B4DU51_MCL1-01      tcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcggccggctgtc
B4DLY8_MCL1-01      ------------------------------------------------------------
B4DG83_MCL1-01      tcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcggccggctgtc
Q07820_MCL1-03      tcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcggccggctgtc
Q07820_MCL1-05      ------------------------------------------------------------
Q07820_MCL1-07      tcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcggccggctgtc
                                                                                

C8YZ26_MCL1-01      ------------------------------------------------------------
Q07820_MCL1-09      ctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
B4E3L8_MCL1-01      ctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
Q07820_MCL1-06      ------------------------------------------------------------
B4DU51_MCL1-01      ctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
B4DLY8_MCL1-01      ------------------------------------------------------------
B4DG83_MCL1-01      ctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
Q07820_MCL1-03      ctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
Q07820_MCL1-05      ------------------------------------------------------------
Q07820_MCL1-07      ctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
                                                                                

C8YZ26_MCL1-01      ------------------------------------------------------------
Q07820_MCL1-09      ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggag
B4E3L8_MCL1-01      ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggag
Q07820_MCL1-06      ------------------------------------------------------------
B4DU51_MCL1-01      cccttgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggag
B4DLY8_MCL1-01      ------------------------------------------------------------
B4DG83_MCL1-01      ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggag
Q07820_MCL1-03      ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggag
Q07820_MCL1-05      ------------------------------------------------------------
Q07820_MCL1-07      ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggag
                                                                                

C8YZ26_MCL1-01      --------------------------ggccaccggcgccaaggacacaaagccaatgggc
Q07820_MCL1-09      attatctctcggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
B4E3L8_MCL1-01      attatctctcggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
Q07820_MCL1-06      -----------------------------caccggcgccaaggacacaaagccaatgggc
B4DU51_MCL1-01      attatctctcggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
B4DLY8_MCL1-01      -------------------------------------ccaaggacacaaagccaatgggc
B4DG83_MCL1-01      attatctctcggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
Q07820_MCL1-03      attatctctcggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
Q07820_MCL1-05      ------------------------------------------------------atgggc
Q07820_MCL1-07      attatctctcggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
                                                                          ******

C8YZ26_MCL1-01      aggtctggggccaccagcaggaaggcgctggagaccttacgacgggttggggatggcgtg
Q07820_MCL1-09      aggtctggggccaccagcaggaaggcgctggagaccttacgacgggttggggatggcgtg
B4E3L8_MCL1-01      aggtctggggccaccagcaggaaggcgctggagaccttacgacgggttggggatggcgtg
Q07820_MCL1-06      aggtctggggccaccagcaggaaggcgctggagaccttacgacgggttggggatggcgtg
B4DU51_MCL1-01      aggtctggggccaccagcaggaaggcgctggagaccttacgacgggttggggatggcgtg
B4DLY8_MCL1-01      aggtctggggccaccagcaggaaggcgctggagaccttacgacgggttggggatggcgtg
B4DG83_MCL1-01      aggtctggggccaccagcaggaaggcgctggagaccttacgacgggttggggatggcgtg
Q07820_MCL1-03      aggtctggggccaccagcaggaaggcgctggagaccttacgacgggttggggatggcgtg
Q07820_MCL1-05      aggtctggggccaccagcaggaaggcgctggagaccttacgacgggttggggatggcgtg
Q07820_MCL1-07      aggtctggggccaccagcaggaaggcgctggagaccttacgacgggttggggatggcgtg
                    ************************************************************

C8YZ26_MCL1-01      cagcgcaaccacgagacggccttccaaggcatgcttcggagactggacatcaaaaacgaa
Q07820_MCL1-09      cagcgcaaccacgagacggccttccaa---------------------------------
B4E3L8_MCL1-01      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
Q07820_MCL1-06      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
B4DU51_MCL1-01      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
B4DLY8_MCL1-01      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
B4DG83_MCL1-01      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
Q07820_MCL1-03      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
Q07820_MCL1-05      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
Q07820_MCL1-07      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
                    ***************************                                 

C8YZ26_MCL1-01      gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaac
Q07820_MCL1-09      ------------------------------------------------------------
B4E3L8_MCL1-01      gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacagcgtaacaaac
Q07820_MCL1-06      gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaac
B4DU51_MCL1-01      gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaac
B4DLY8_MCL1-01      gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaac
B4DG83_MCL1-01      gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaac
Q07820_MCL1-03      gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaac
Q07820_MCL1-05      gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaac
Q07820_MCL1-07      gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaac
                                                                                

C8YZ26_MCL1-01      tggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagacc
Q07820_MCL1-09      ------------------------------------------------------------
B4E3L8_MCL1-01      tggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagacc
Q07820_MCL1-06      tggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagacc
B4DU51_MCL1-01      tggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagacc
B4DLY8_MCL1-01      tggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagacc
B4DG83_MCL1-01      tggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagacc
Q07820_MCL1-03      tggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagacc
Q07820_MCL1-05      tggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagacc
Q07820_MCL1-07      tggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagacc
                                                                                

C8YZ26_MCL1-01      ataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
Q07820_MCL1-09      ------------------------------------------------------------
B4E3L8_MCL1-01      ataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
Q07820_MCL1-06      ataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
B4DU51_MCL1-01      ataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
B4DLY8_MCL1-01      ataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
B4DG83_MCL1-01      ataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
Q07820_MCL1-03      ataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
Q07820_MCL1-05      ataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
Q07820_MCL1-07      ataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
                                                                                

C8YZ26_MCL1-01      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccaa
Q07820_MCL1-09      -----------------------------------ggatgggtttgtggagttcttccat
B4E3L8_MCL1-01      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
Q07820_MCL1-06      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
B4DU51_MCL1-01      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
B4DLY8_MCL1-01      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
B4DG83_MCL1-01      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
Q07820_MCL1-03      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
Q07820_MCL1-05      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
Q07820_MCL1-07      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
                                                       ************************ 

C8YZ26_MCL1-01      gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgga
Q07820_MCL1-09      gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgga
B4E3L8_MCL1-01      gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgga
Q07820_MCL1-06      gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgga
B4DU51_MCL1-01      gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgga
B4DLY8_MCL1-01      gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgga
B4DG83_MCL1-01      gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgga
Q07820_MCL1-03      gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgga
Q07820_MCL1-05      gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgga
Q07820_MCL1-07      gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgga
                    ************************************************************

C8YZ26_MCL1-01      gtaggagctggtttggcatatctaaaaagatag-----------
Q07820_MCL1-09      gtaggagctggtttggcatatctaataagatagccttactgtaa
B4E3L8_MCL1-01      gtaggagctggtttggcatatctaataagatag-----------
Q07820_MCL1-06      gtaggagctggtttggcatatctaataagatag-----------
B4DU51_MCL1-01      gtaggagctggtttggcatatctaataagatag-----------
B4DLY8_MCL1-01      gtaggagctggtttggcatatctaataagatag-----------
B4DG83_MCL1-01      gtaggagctggtttggcatatctaataagatag-----------
Q07820_MCL1-03      gtaggagctggtttggcatatctaataagatag-----------
Q07820_MCL1-05      gtaggagctggtttggcatatctaataagatag-----------
Q07820_MCL1-07      gtaggagctggtttggcatatctaataagatag-----------
                    ************************* *******           

© 1998-2022Legal notice