Dataset for CDS BCL-2 of organism Oryctolagus cuniculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A5F9CRQ4_BCL2-01      atggcgcacgccgggcgaacagggtacgacaaccgggagatcgtgatgaa
A0A5F9CRQ4_BCL2-02      atggcgcacgccgggcgaacagggtacgacaaccgggagatcgtgatgaa
                        **************************************************

A0A5F9CRQ4_BCL2-01      gtacatccactataagctgtcccagaggggctacgagtgggacgctgggg
A0A5F9CRQ4_BCL2-02      gtacatccactataagctgtcccagaggggctacgagtgggacgctgggg
                        **************************************************

A0A5F9CRQ4_BCL2-01      acgcgggcgccgcctccgcgccgggcgtcttctcctcccagcccgcgccc
A0A5F9CRQ4_BCL2-02      acgcgggcgccgcctccgcgccgggcgtcttctcctcccagcccgcgccc
                        **************************************************

A0A5F9CRQ4_BCL2-01      gctgcgccccgggacccggccgccaggacctcgccgccgccgccgccggc
A0A5F9CRQ4_BCL2-02      gctgcgccccgggacccggccgccaggacctcgccgccgccgccgccggc
                        **************************************************

A0A5F9CRQ4_BCL2-01      cgccgcggggcccgcgctcagcccggtgccacctgtggtccacctgaccc
A0A5F9CRQ4_BCL2-02      cgccgcggggcccgcgctcagcccggtgccacctgtggtccacctgaccc
                        **************************************************

A0A5F9CRQ4_BCL2-01      tccgccaggcgggcgacgacttctcccggcgctaccgccgcgacttcgcg
A0A5F9CRQ4_BCL2-02      tccgccaggcgggcgacgacttctcccggcgctaccgccgcgacttcgcg
                        **************************************************

A0A5F9CRQ4_BCL2-01      gagatgtccagccagctgcacctgacgccctttcacgcgagggggcgctt
A0A5F9CRQ4_BCL2-02      gagatgtccagccagctgcacctgacgccctttcacgcgagggggcgctt
                        **************************************************

A0A5F9CRQ4_BCL2-01      tgccacggtggtggaggagctcttcagggatggggtgaactgggggagga
A0A5F9CRQ4_BCL2-02      tgccacggtggtggaggagctcttcagggatggggtgaactgggggagga
                        **************************************************

A0A5F9CRQ4_BCL2-01      ttgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
A0A5F9CRQ4_BCL2-02      ttgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
                        **************************************************

A0A5F9CRQ4_BCL2-01      cgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagta
A0A5F9CRQ4_BCL2-02      cgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagta
                        **************************************************

A0A5F9CRQ4_BCL2-01      cctgaaccggcacctgcacacctggatccaggataatggaggct------
A0A5F9CRQ4_BCL2-02      cctgaaccggcacctgcacacctggatccaggataatggaggctgggcag
                        ********************************************      

A0A5F9CRQ4_BCL2-01      -------------------gggatgccttcg-------------------
A0A5F9CRQ4_BCL2-02      acaaaagcccttggatctcggggtgtctttgtacttctcggagagccacc
                                           *** ** *** *                   

A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      ccaggagcacattccctgacggagggctcagccacctcttccgcctcatt
                                                                          

A0A5F9CRQ4_BCL2-01      ----------------------------------------tggaa-----
A0A5F9CRQ4_BCL2-02      atactctgctcagcaccgagaagcctggcatggtttctgctggaatgaaa
                                                                *****     

A0A5F9CRQ4_BCL2-01      -----------------ctgtacggccccagcg-----------------
A0A5F9CRQ4_BCL2-02      agattggcagagctgccctagacaacagcaccgcaaaacactgtggcaga
                                         **  **  *  ** **                 

A0A5F9CRQ4_BCL2-01      --------------------------------------tgcggcctctgt
A0A5F9CRQ4_BCL2-02      aggtttggtctacataccaaggcagccaaagtattaattgcattctctgt
                                                              ***   ******

A0A5F9CRQ4_BCL2-01      -----------------------------------------------cag
A0A5F9CRQ4_BCL2-02      gatcgcaaaaaaggcgctgaattcttctcttcacgttttcagaatgacag
                                                                       ***

A0A5F9CRQ4_BCL2-01      acttctcct-----------------------------------------
A0A5F9CRQ4_BCL2-02      acttctgctctgccagctctgagcacagcgcatcacatggaaaggagcgg
                        ****** **                                         

A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      ctagatttgagggggaaaactcagaagacggatgatggtagccagctagt
                                                                          

A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      tcttcaaaaagagttccccgtgaactgtttcggaactgtggaaggtcaga
                                                                          

A0A5F9CRQ4_BCL2-01      ----------gggtg---------------------tctctgaagacttt
A0A5F9CRQ4_BCL2-02      agcagagtaaggatgtacttccatgcatttacataatctacgaagccttt
                                  ** **                     ***  **** ****

A0A5F9CRQ4_BCL2-01      gttca--------------------------------gcctggcc--ctg
A0A5F9CRQ4_BCL2-02      tcccatcttgaagtcttactttatgtgttgcagtgggacctggccagctg
                           **                                 *******  ***

A0A5F9CRQ4_BCL2-01      atag---------gagc----------ttgcatcaccctcggtgcct---
A0A5F9CRQ4_BCL2-02      ccagctgcagtttgagcccatttccttttgcattggtttctgtgtccagg
                          **         ****          ******     ** *** *    

A0A5F9CRQ4_BCL2-01      ---acctgggccacaagtga
A0A5F9CRQ4_BCL2-02      gaaaccttgtttctctatga
                           **** *        ***

© 1998-2022Legal notice