Dataset for CDS BCL-2-like of organism Loxodonta africana

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G3T8E6_BCL2A1-01      --------------------------------------------------
G3SPN0_BCL2L1-01      --------------------------------------------------
G3SLZ1_BCL2-01        --------------------------------------------------
G3SLZ1_BCL2-02        --------------------------------------------------
G3TMU7_BCL2L2-01      --------------------------------------------------
G3T756_MCL1-01        atgttcggcttcaagagaaacgcagtaatcggactcaacctttactgtgg
G3TVG9_MCL1-01        --------------------------------------------------

G3T8E6_BCL2A1-01      --------------------------------------------------
G3SPN0_BCL2L1-01      --------------------------------------------------
G3SLZ1_BCL2-01        --------------------------------------------------
G3SLZ1_BCL2-02        --------------------------------------------------
G3TMU7_BCL2L2-01      --------------------------------------------------
G3T756_MCL1-01        gggggccggcttgggggccggcggctgcgccacccctccgggagggcgac
G3TVG9_MCL1-01        --------------------------------------------------

G3T8E6_BCL2A1-01      --------------------------------------------------
G3SPN0_BCL2L1-01      --------------------------------------------------
G3SLZ1_BCL2-01        --------------------------------------------------
G3SLZ1_BCL2-02        --------------------------------------------------
G3TMU7_BCL2L2-01      --------------------------------------------------
G3T756_MCL1-01        ttccagctcctggaaaggaggccacggcccggcaagaggtagggggaggg
G3TVG9_MCL1-01        --------------------------------------------------

G3T8E6_BCL2A1-01      --------------------------------------------------
G3SPN0_BCL2L1-01      --------------------------------------------------
G3SLZ1_BCL2-01        --------------------------------------------------
G3SLZ1_BCL2-02        --------------------------------------------------
G3TMU7_BCL2L2-01      --------------------------------------------------
G3T756_MCL1-01        gacgccggcgcgagccccccggccgctgtcgctccggacggccggagggt
G3TVG9_MCL1-01        --------------------------------------------------

G3T8E6_BCL2A1-01      ---------------------------------atgactgactgtgagt-
G3SPN0_BCL2L1-01      ---------------------------atgtctcagagcaaccgggagct
G3SLZ1_BCL2-01        -------atggcgcacgcagggagaacaggttatgacaaccgggagatag
G3SLZ1_BCL2-02        -------atggcgcacgcagggagaacaggttatgacaaccgggagatag
G3TMU7_BCL2L2-01      ----------------------------------tatattcatgttagtc
G3T756_MCL1-01        cgtgcggccggcgcccattggcgccgagggccccgacgtcactgcgattc
G3TVG9_MCL1-01        -------------------ggagcccagggccccagcgtcaccgcgaccc
                                                                 *  *   

G3T8E6_BCL2A1-01      ------------------ttggatacatttac------------------
G3SPN0_BCL2L1-01      ggtggttgactttctctcctacaagctttcccagaaaggatac-agttgg
G3SLZ1_BCL2-01        tgatgaagt--atatccactataagctgtcgcagcggggctacgaatggg
G3SLZ1_BCL2-02        tgatgaagt--atatccactataagctgtcgcagcggggctacgaatggg
G3TMU7_BCL2L2-01      tttc---atccctgactcttgcagccgcccgcatggcgacccc-------
G3T756_MCL1-01        ccgcgaggccgacgttctttgcgcccacccgccgcgcgtcgcc-------
G3TVG9_MCL1-01        ctgcgaggcccatgctctttgcatccatcccctgcacgtcgcc-------
                                         *     *     *                  

G3T8E6_BCL2A1-01      --------------------------------------------------
G3SPN0_BCL2L1-01      agtcagtttagtgatgtggaggagaataggactggggcctcggaaggcac
G3SLZ1_BCL2-01        aggc-------------tggcgaagctagcgccgcgccccccggggccgc
G3SLZ1_BCL2-02        aggc-------------tggcgaagct-----------------------
G3TMU7_BCL2L2-01      agcc-------------tca----------gccccagacacacgggctct
G3T756_MCL1-01        -gcc-------------tgtggagatggaggctctagccgccgacgccat
G3TVG9_MCL1-01        -gcc-------------tgaggaggcgaatgcctcagttgcggaggccat

G3T8E6_BCL2A1-01      --------------------------------------------------
G3SPN0_BCL2L1-01      tgaatcc-------------------------------------------
G3SLZ1_BCL2-01        tcccgcgccgggcgtcctctcttctccgcccgcggcgccccggggcccgg
G3SLZ1_BCL2-02        -------------------------------------------------g
G3TMU7_BCL2L2-01      ggtggca-------------------------------------------
G3T756_MCL1-01        catgtcgcccgaag------------------------------------
G3TVG9_MCL1-01        catgtcagctgaag------------------------------------

G3T8E6_BCL2A1-01      -------aagctggtccaggacta----------tctgaagta-------
G3SPN0_BCL2L1-01      -------gagatggagatccccagtgccatcaatggcaacccatcccggc
G3SLZ1_BCL2-01        acaccaggacctcgcc-gctccag----------gctga-----------
G3SLZ1_BCL2-02        acaccaggacctcgcc-gctccag----------gctga-----------
G3TMU7_BCL2L2-01      -------gactttgtgggctacaa----------gctgaggc------ag
G3T756_MCL1-01        -----aggagctggacgggtacga----------gccggagccgctcggg
G3TVG9_MCL1-01        -----aggagctgggcaggtacaa----------gctggagacgctgggg
                              *  * *       *                            

G3T8E6_BCL2A1-01      -----------cgtcctgcagatacc-------------acaacctgcag
G3SPN0_BCL2L1-01      acctggcagacagccctgcggtgaatggagctact----ggccacagcag
G3SLZ1_BCL2-01        -----cccggccgcgcagccggcgctcagcccggt----gccacctgtag
G3SLZ1_BCL2-02        -----cccggccgcgcagccggcgctcagcccggt----gccacctgtag
G3TMU7_BCL2L2-01      aag-----ggttatgtttgtggagctggccccgg--ggagggcccagcag
G3T756_MCL1-01        aagcggccggctgtttttccccggctggggctggtcggggaggccagtaa
G3TVG9_MCL1-01        aagcggccagctgcccttcccctgctggtgcttgtgggggaagccagtaa
                                                                  * * * 

G3T8E6_BCL2A1-01      ctggttca------------------------------------------
G3SPN0_BCL2L1-01      cagcttggatgcccgggaggtgatccccatggc-----------------
G3SLZ1_BCL2-01        ttcacctg------------------------------------------
G3SLZ1_BCL2-02        ttcacctg------------------------------------------
G3TMU7_BCL2L2-01      ctgacccgctgcac------------------------------------
G3T756_MCL1-01        tggccccggtaccgacgggtcactaccctcgacgccgcccctagcagagg
G3TVG9_MCL1-01        ctgccctggtacgcacggggcacttccctcaacgcagcccccagcagagg

G3T8E6_BCL2A1-01      --------agcaaaacgtccagagtgttacaaaatgtggctttctcagtt
G3SPN0_BCL2L1-01      agcagtgaagcaagctctgagggag---gcaggcgatgagttcgaactgc
G3SLZ1_BCL2-01        -----------accttgcgccag-----gccggcgacgacttctccaggc
G3SLZ1_BCL2-02        -----------accttgcgccag-----gccggcgacgacttctccaggc
G3TMU7_BCL2L2-01      ----------caagccatgcgggca---gctggagatga--gttcgagac
G3T756_MCL1-01        aggaggaggacgagttgtaccggcagtcgctagagattatctctcggtac
G3TVG9_MCL1-01        aagaagaagacaagttgtacccgcaatcgctggatattatctttcggtac

G3T8E6_BCL2A1-01      caaaaaga------------------------------------------
G3SPN0_BCL2L1-01      ------------ggtaccggcg----------------------------
G3SLZ1_BCL2-01        ------------gctaccgccgcga-------------------------
G3SLZ1_BCL2-02        ------------gctaccgccgcga-------------------------
G3TMU7_BCL2L2-01      cc----------gcttccggcgc---------------------------
G3T756_MCL1-01        cttcaggagcaggcaaccggcgccaaggacaccaagccaatgggcgggtc
G3TVG9_MCL1-01        cttcacgagcaggccatcggcgcca-----------------------cc

G3T8E6_BCL2A1-01      ---------------------------------------agttgaaaaga
G3SPN0_BCL2L1-01      ----------------------------ggcattcagtgacctg------
G3SLZ1_BCL2-01        -------------------------------cttcgccgagatg------
G3SLZ1_BCL2-02        -------------------------------cttcgccgagatg------
G3TMU7_BCL2L2-01      ----------------------------accttct-ctgatctg------
G3T756_MCL1-01        tggggcggccagcaggaaggcgttagagaccctccggcgagtcgcggacg
G3TVG9_MCL1-01        cagggccgccagctggaaggggtgagaaacctgcc-gcgggtcgcagacg

G3T8E6_BCL2A1-01      atttgaaaccctgcttggacaattt-----------tgttgtcatctcca
G3SPN0_BCL2L1-01      ----acatcccagc----------------------tccacatcacccca
G3SLZ1_BCL2-01        ----tcgagccagc----------------------tgcacctgactccc
G3SLZ1_BCL2-02        ----tcgagccagc----------------------tgcacctgactccc
G3TMU7_BCL2L2-01      ----gcagcccagc----------------------tgcatgtgacccca
G3T756_MCL1-01        gggtgcagcgcaaccacgagacggccttccaaggaatgcttcggaaactg
G3TVG9_MCL1-01        gtgtgcagcgcaacgaggagacggtctcccaaggcatgcttcggaaaccg
                                *  *                      *          *  

G3T8E6_BCL2A1-01      ttgataccgcccaaaca-------------atattcaagcaa-gtgatgg
G3SPN0_BCL2L1-01      gggacagcatatcagag---------------ctttgagcag-gtagtga
G3SLZ1_BCL2-01        ttcaccgcgaggggacg---------------ctttgccacg-gtggtgg
G3SLZ1_BCL2-02        ttcaccgcgaggggacg---------------ctttgccacg-gtggtgg
G3TMU7_BCL2L2-01      ggctcagcccagcaacg---------------cttcacccaggtctctga
G3T756_MCL1-01        gaca----tcaaaaacgaagatgatgtcaaatctttatctcgagtaatgg
G3TVG9_MCL1-01        gact----tcaaaaacgaaaatgatgtgaaatctttgtctggagcgatgg
                                                       **            ** 

G3T8E6_BCL2A1-01      aaaaggaatttgaagatggcatcattaactggggaagaattgtgaccata
G3SPN0_BCL2L1-01      acgaactcttccgggatggggt---gaactggggtcgcattgtggccttt
G3SLZ1_BCL2-01        aggagctcttcagggacggggt---gaactgggggcggattgtggccttc
G3SLZ1_BCL2-02        aggagctcttcagggacggggt---gaactgggggcggattgtggccttc
G3TMU7_BCL2L2-01      tgaactcttccaa----gggggccccaactggggccgccttgtggccttc
G3T756_MCL1-01        cccatgttttcagtgacgggataacaaactggggcagaattgtgactctc
G3TVG9_MCL1-01        tccatgttttcagtggtggaataacaaaatggggcagaattgtgact---
                         *    *        **       ** *****  *  ***** *    

G3T8E6_BCL2A1-01      tttgcatttggaggtattctcatcaagaaacttctaagggagcgaattgc
G3SPN0_BCL2L1-01      ttctccttcggtggggcactgtgcgt--------ggaaagcgtagacaa-
G3SLZ1_BCL2-01        tttgagttcggtggggtcatgtgtgt--------ggagagcgtcaaccg-
G3SLZ1_BCL2-02        tttgagttcggtggggtcatgtgtgt--------ggagagcgtcaaccg-
G3TMU7_BCL2L2-01      tttgtctttggggctgctctgtgtgc--------tgagagtgtcaacaa-
G3T756_MCL1-01        atatcttttggtgc--ctttgtggccaaacacttgaagagcgtaaacca-
G3TVG9_MCL1-01        atatcttttggtgc--ctttgtggtcaaacacttcgggagcataaacca-
                       *    ** ** *      *                   *     *    

G3T8E6_BCL2A1-01      cccagatgtggatacttacaaga-agatttcttcttttgttgctgag---
G3SPN0_BCL2L1-01      -ggagatgcaggtattggtgagtcggatcgcaacttggatggctact---
G3SLZ1_BCL2-01        -ggagatgtcgcccctggtggacaacatcgccctctggatgactgag---
G3SLZ1_BCL2-02        -ggagatgtcgcccctggtggacaacatcgccctctggatgactgag---
G3TMU7_BCL2L2-01      -ggagatggagccactggtgggacaagtgcaggagtggat----ggtggt
G3T756_MCL1-01        -aga----aagccgc--atcgaaccattagcagaaagtatcacagatgtt
G3TVG9_MCL1-01        -ag-----aagctgc-------------agcagaatgtatcacagatgtt
                                *                            *          

G3T8E6_BCL2A1-01      -ttcatagtggataacacagcagagtggataaggcaaaacggaggctggg
G3SPN0_BCL2L1-01      -tacctgaatgaccacctagagccttggatccaggagaacggcggctgg-
G3SLZ1_BCL2-01        -tacctgaaccggcacctgcacacctggatccaggataacggaggatgg-
G3SLZ1_BCL2-02        -tacctgaaccggcacctgcacacctggatccaggataacggaggatggg
G3TMU7_BCL2L2-01      ctacctggagacgcggctggctgactggatccacagcagtgggggctgg-
G3T756_MCL1-01        ct-cgtaaggacgaaaagg---gactggttagtcaaacaaagaggctgg-
G3TVG9_MCL1-01        ct-cctaag---gaaacgg---tactgcttagacaaacgaaggggcggg-
                       * * *                   **  *           * **  ** 

G3T8E6_BCL2A1-01      aaaatggc-----------tttgtg--------------------aagaa
G3SPN0_BCL2L1-01      --gtaaggaccacgccccttttgtgcttcagtacctcagtgaaggaagac
G3SLZ1_BCL2-01        --gatgcc-----------tttgtg-------------------------
G3SLZ1_BCL2-02        taggtgca-----------tgtgtg-------------------------
G3TMU7_BCL2L2-01      --gcggag-----------ttcaca-------------------------
G3T756_MCL1-01        --gatggg-----------tttgtg-------------------------
G3TVG9_MCL1-01        --gatggg-----------cttgtg-------------------------

G3T8E6_BCL2A1-01      gtttgaacctaggtctggctggctgacttttctggaagttaca-------
G3SPN0_BCL2L1-01      atagcctatgtgttcattcaggtcaaaacctatgcaagtggga-------
G3SLZ1_BCL2-01        ---------ga--------actgtatggccccaacatgcgacc-------
G3SLZ1_BCL2-02        ---------g----------------------------------------
G3TMU7_BCL2L2-01      ---------gc-tctatacggggacggggccctggaggaggcacggcgtc
G3T756_MCL1-01        ---------gagttcttccatgtagaggacctagaaggtggca-------
G3TVG9_MCL1-01        ---------gagttcgtccacgtaaaggacccacagggcgact-------

G3T8E6_BCL2A1-01      ----------------------ggaaagatttgtgaaatgttatttctcc
G3SPN0_BCL2L1-01      ----------------------agttagtccagtgt----ttcctcaccc
G3SLZ1_BCL2-01        --------------------tctgtttgatttctcc----tggctgtctc
G3SLZ1_BCL2-02        -------------------------------------------------t
G3TMU7_BCL2L2-01      tgcgggaggggaactgggcatcagtgaggacagtgc----tgacgggggc
G3T756_MCL1-01        ------------------------tcagaaatgtgc----tgctggcttt
G3TVG9_MCL1-01        ------------------------gtagaaatgtgc----agctggcttt

G3T8E6_BCL2A1-01      tgaagcaat-----------------------------------------
G3SPN0_BCL2L1-01      tgacacaatggttcaccacccaa---------------------------
G3SLZ1_BCL2-01        tgaagacactgctcagtctggccctggtgggagcttgcatcaccctgggt
G3SLZ1_BCL2-02        tgaa----------------------------------------------
G3TMU7_BCL2L2-01      tgtggcactgggggccctggtaactgtaggg-------------------
G3T756_MCL1-01        tgcaggtgttgctggagtaggagctggtttg-------------------
G3TVG9_MCL1-01        tgcaggt-------------------------------------------

G3T8E6_BCL2A1-01      -------------actattga
G3SPN0_BCL2L1-01      ---------------------
G3SLZ1_BCL2-01        gcttacctggggcacaagtga
G3SLZ1_BCL2-02        ---------------------
G3TMU7_BCL2L2-01      gccttttttgctagcaagtga
G3T756_MCL1-01        gcatatctaataagatag---
G3TVG9_MCL1-01        ---------------------

© 1998-2022Legal notice