Dataset for CDS BAX of Organism Callorhinchus milii

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W3KFA8_BAX-01      --------------------------------------------------
A0A4W3JFN9_BAX-01      atgaaaggaccgagagtcagagagagcagtgactcactggatgctacgcg
A0A4W3JNU0_BAX-01      --------------------------------------------------
A0A4W3JNU0_BAX-02      ------------ggcttcaggtcgcgcgttgac-----------------
                                                                         

A0A4W3KFA8_BAX-01      ---tttatcatggagcgcctg-----------------------------
A0A4W3JFN9_BAX-01      gaagttaccagcgatcacacagtcttgtcttgttgttttggaggtgtttt
A0A4W3JNU0_BAX-01      ---tttatcatggatcgca-------------------------------
A0A4W3JNU0_BAX-02      gggtttatcatggatcgca-------------------------------
                           *** **  ** * *                                

A0A4W3KFA8_BAX-01      ----------------------------------------agcaga----
A0A4W3JFN9_BAX-01      cctggctgttcaaactcaaatcctcccgagggtttaccatcgcagagttt
A0A4W3JNU0_BAX-01      ----------------------------------------cgcaga----
A0A4W3JNU0_BAX-02      ----------------------------------------cgcaga----
                                                                *****    

A0A4W3KFA8_BAX-01      ------------------------------------agcaccgagcagtt
A0A4W3JFN9_BAX-01      gcagtaactttgcatcgactttgcggtggggggtgcggtgtgggggtttg
A0A4W3JNU0_BAX-01      ----------------------------------gaggtgccgaggactg
A0A4W3JNU0_BAX-02      ----------------------------------gaggtgccgaggactg
                                                            *    * *   * 

A0A4W3KFA8_BAX-01      cggggtgtccctgg------------------------------------
A0A4W3JFN9_BAX-01      cgggaggggctcagccatggagagcttcagggcatcaggagctgctgatg
A0A4W3JNU0_BAX-01      c--gaggtgctcg-------------tcaccgtgt---------------
A0A4W3JNU0_BAX-02      c--gaggtgctcg-------------tcaccgtgt---------------
                       *  *  *  *                                        

A0A4W3KFA8_BAX-01      -----ctaacttggggccatttccgcaggacacgg---------------
A0A4W3JFN9_BAX-01      gaagactgagtcgggaggaaggtgacagagctccagattcctcggatgag
A0A4W3JNU0_BAX-01      -----ccgacctgggggg-------ccgggc-------------------
A0A4W3JNU0_BAX-02      -----ccgacctgggggg-------ccgggc-------------------
                            *  *   ***          * *  *                   

A0A4W3KFA8_BAX-01      ---------ggaccgccc-----acccccact------------------
A0A4W3JFN9_BAX-01      atccttatgagacaagctggaggactcatgcgtagatttgtgctggagac
A0A4W3JNU0_BAX-01      ---------agacgagctgaataaaccctgct------------------
A0A4W3JNU0_BAX-02      ---------agacgagctgaataaaccctgct------------------
                                 ***   *      *  *   *                   

A0A4W3KFA8_BAX-01      ------tgaaggga-----------------------------atgagcg
A0A4W3JFN9_BAX-01      aatccatgaagaagatccagaaatttcactcagccccgatgaactgggcg
A0A4W3JNU0_BAX-01      ------tgaagagg-----------------------------ctgggtg
A0A4W3JNU0_BAX-02      ------tgaagagg-----------------------------ctgggtg
                             *****                                 ** * *

A0A4W3KFA8_BAX-01      at---------------------------------------------tct
A0A4W3JFN9_BAX-01      gcactcagagtgagattgatgatcctaccatcaagcatgtaacccagtgt
A0A4W3JNU0_BAX-01      tc---------------------------------------------tgc
A0A4W3JNU0_BAX-02      tc---------------------------------------------tgc
                                                                      *  

A0A4W3KFA8_BAX-01      ctgagaaggatcggggatttgctcagcaatgacaccaagctgcagcaggg
A0A4W3JFN9_BAX-01      ttgaggacaattggggatgaactgaacagaaatgttgaactgcagtgcct
A0A4W3JNU0_BAX-01      ctgcgacagatcggggatgagctggacggcaacgtggagttgcaaaggat
A0A4W3JNU0_BAX-02      ctgcgacagatcggggatgagctggacggcaacgtggagttgcaaaggat
                        ** *    ** ******   **   *    *     *  ****      

A0A4W3KFA8_BAX-01      aattgctcacatg---agcgactgctccaaggaaaccttcttcaaagtgg
A0A4W3JFN9_BAX-01      gattgacagcattcctatcaattctgcccgagatgttttgtgccaagtag
A0A4W3JNU0_BAX-01      gatcaacaggatttccaccagctgccccaaagagaccttcttccaagtgg
A0A4W3JNU0_BAX-02      gatcaacaggatttccaccagctgccccaaagagaccttcttccaagtgg
                        **       **    * *   *   **   **    ** * * **** *

A0A4W3KFA8_BAX-01      ccgaggaggttttctctgacggcgtcgtcaactggggccgagtggtcatg
A0A4W3JFN9_BAX-01      ctggaaagctcatttctgatgaat---tgaactggggaagaattgtgtcc
A0A4W3JNU0_BAX-01      ccaaggagctgttttccgatggagtcatcaactggggacgagtggtcact
A0A4W3JNU0_BAX-02      ccaaggagctgttttccgatggagtcatcaactggggacgagtggtcact
                       *     ** *  * ** ** *      * ********  ** * **    

A0A4W3KFA8_BAX-01      ctcttcatcttcgcctgcatcttggtgctgaaggcgctgacccagtccat
A0A4W3JFN9_BAX-01      ttcttctactttgccggtaaacttatttacaaggcactgatgcaaaatct
A0A4W3JNU0_BAX-01      ctcttctactttgcctgcaagttcgtcgtcaaggccgtgtgccagaagct
A0A4W3JNU0_BAX-02      ctcttctactttgcctgcaagttcgtcgtcaaggccgtgtgccagaagct
                        *****  *** *** * *   *  *    *****  **   **     *

A0A4W3KFA8_BAX-01      ccccaacattatccaaaccgtcatcagttggaccatggagtttatgcaga
A0A4W3JFN9_BAX-01      gagaggaatgatccaacctattattaattggtccttggattttatccaaa
A0A4W3JNU0_BAX-01      cccagagctgatccagaccataatcacgtggactctggaatacatccaag
A0A4W3JNU0_BAX-02      cccagagctgatccagaccataatcacgtggactctggaatacatccaag
                               * *****  *  * ** *  *** *  **** *  ** **  

A0A4W3KFA8_BAX-01      gatatgtcctgcagtggatccaaaaccatggtggctgggtaagtgacca-
A0A4W3JFN9_BAX-01      accgtgtggttccatggattcagctgcaaggaggttgggagaatatctat
A0A4W3JNU0_BAX-01      agaatatcctccagtggatccgggagcacggtggctgggatgctat----
A0A4W3JNU0_BAX-02      agaatatcctccagtggatccgggagcacggtggctgggatgctat----
                           * *  * *  ***** *     ** ** ** ****    *      

A0A4W3KFA8_BAX-01      -----tctcacaacaacaac--aacaaattacatcgccatttacgcagcg
A0A4W3JFN9_BAX-01      tcttacttcggaactccaacctggcagatgtttgcggt------------
A0A4W3JNU0_BAX-01      -----cctcggcaccccgacctggcaga--ctgtcagc------------
A0A4W3JNU0_BAX-02      -----cctcggcaccccgacctggcaga--ctgtcagc------------
                              **   **  * **    ** *      *               

A0A4W3KFA8_BAX-01      cttttcacaccaggacaggtcaggaccacccaaggcgcgtatattct---
A0A4W3JFN9_BAX-01      cttttcagctag--------catcattaccggtgttttggctttgatgaa
A0A4W3JNU0_BAX-01      atcttcatcctggg---ggtcatcactaccctcgtggtgg-tgcggtgga
A0A4W3JNU0_BAX-02      atcttcatcctggg---ggtcatcactaccctcgtggtgg-tgcggtgga
                        * ****             **  *  ***   *    *  *    *   

A0A4W3KFA8_BAX-01      ---catctaa
A0A4W3JFN9_BAX-01      actgacctaa
A0A4W3JNU0_BAX-01      a--gtcttaa
A0A4W3JNU0_BAX-02      a--gtcttaa
                              ***

© 1998-2023Legal notice