Dataset for CDS BAX of Organism Callorhinchus milii

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A4W3JFN9_BAX-01 BCL2-associated X gene OS=[Eukaryota] Callorhinchus milii GN=BAX (length=837 residues).
atgaaaggaccgagagtcagagagagcagtgactcactggatgctacgcggaagttaccagcgatcacacagtcttgtct
tgttgttttggaggtgttttcctggctgttcaaactcaaatcctcccgagggtttaccatcgcagagtttgcagtaactt
tgcatcgactttgcggtggggggtgcggtgtgggggtttgcgggaggggctcagccatggagagcttcagggcatcagga
gctgctgatggaagactgagtcgggaggaaggtgacagagctccagattcctcggatgagatccttatgagacaagctgg
aggactcatgcgtagatttgtgctggagacaatccatgaagaagatccagaaatttcactcagccccgatgaactgggcg
gcactcagagtgagattgatgatcctaccatcaagcatgtaacccagtgtttgaggacaattggggatgaactgaacaga
aatgttgaactgcagtgcctgattgacagcattcctatcaattctgcccgagatgttttgtgccaagtagctggaaagct
catttctgatgaattgaactggggaagaattgtgtccttcttctactttgccggtaaacttatttacaaggcactgatgc
aaaatctgagaggaatgatccaacctattattaattggtccttggattttatccaaaaccgtgtggttccatggattcag
ctgcaaggaggttgggagaatatctattcttacttcggaactccaacctggcagatgtttgcggtcttttcagctagcat
cattaccggtgttttggctttgatgaaactgacctaa
>gnl|bcl2dbcds|A0A4W3JNU0_BAX-01 BCL2-associated X gene OS=[Eukaryota] Callorhinchus milii GN=BAX (length=501 residues).
tttatcatggatcgcacgcagagaggtgccgaggactgcgaggtgctcgtcaccgtgtccgacctggggggccgggcaga
cgagctgaataaaccctgcttgaagaggctgggtgtctgcctgcgacagatcggggatgagctggacggcaacgtggagt
tgcaaaggatgatcaacaggatttccaccagctgccccaaagagaccttcttccaagtggccaaggagctgttttccgat
ggagtcatcaactggggacgagtggtcactctcttctactttgcctgcaagttcgtcgtcaaggccgtgtgccagaagct
cccagagctgatccagaccataatcacgtggactctggaatacatccaagagaatatcctccagtggatccgggagcacg
gtggctgggatgctatcctcggcaccccgacctggcagactgtcagcatcttcatcctgggggtcatcactaccctcgtg
gtggtgcggtggaagtcttaa
>gnl|bcl2dbcds|A0A4W3JNU0_BAX-02 BCL2-associated X gene OS=[Eukaryota] Callorhinchus milii GN=BAX (length=525 residues).
ggcttcaggtcgcgcgttgacgggtttatcatggatcgcacgcagagaggtgccgaggactgcgaggtgctcgtcaccgt
gtccgacctggggggccgggcagacgagctgaataaaccctgcttgaagaggctgggtgtctgcctgcgacagatcgggg
atgagctggacggcaacgtggagttgcaaaggatgatcaacaggatttccaccagctgccccaaagagaccttcttccaa
gtggccaaggagctgttttccgatggagtcatcaactggggacgagtggtcactctcttctactttgcctgcaagttcgt
cgtcaaggccgtgtgccagaagctcccagagctgatccagaccataatcacgtggactctggaatacatccaagagaata
tcctccagtggatccgggagcacggtggctgggatgctatcctcggcaccccgacctggcagactgtcagcatcttcatc
ctgggggtcatcactaccctcgtggtggtgcggtggaagtcttaa
>gnl|bcl2dbcds|A0A4W3KFA8_BAX-01 BCL2-associated X gene OS=[Eukaryota] Callorhinchus milii GN=BAX (length=513 residues).
tttatcatggagcgcctgagcagaagcaccgagcagttcggggtgtccctggctaacttggggccatttccgcaggacac
ggggaccgcccacccccacttgaagggaatgagcgattctctgagaaggatcggggatttgctcagcaatgacaccaagc
tgcagcagggaattgctcacatgagcgactgctccaaggaaaccttcttcaaagtggccgaggaggttttctctgacggc
gtcgtcaactggggccgagtggtcatgctcttcatcttcgcctgcatcttggtgctgaaggcgctgacccagtccatccc
caacattatccaaaccgtcatcagttggaccatggagtttatgcagagatatgtcctgcagtggatccaaaaccatggtg
gctgggtaagtgaccatctcacaacaacaacaacaaattacatcgccatttacgcagcgcttttcacaccaggacaggtc
aggaccacccaaggcgcgtatattctcatctaa
© 1998-2023Legal notice