Dataset for CDS MCL-1 of organism Panthera leo

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C8Y0M9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Panthera leo GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggctggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggctgtggggaaggaggccacggcccggcgagaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
cccattggtgccgagggccccgacgtcaccgcgacccctccgaagctgctgttcttcgcggccacccgctgtgcgtcgcc
gcctgaaaagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggaactagacgggtacgagccagaacctc
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgactggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttcttgtgaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccac
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8C8Y0M9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Panthera leo GN=MCL-1 (length=594 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggctggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggcgactggcgccaaggacgcgaaaccactgggcgggtctggggcggccagcc
gaaaggcgttagagaccctccgacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaa
ctggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgca
tcgaaccattagcagaaagcatcacagatgttcttgtgaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccacgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
© 1998-2022Legal notice