Dataset for CDS BCL2L1 of organism Fundulus heteroclitus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q2NRP4_BCL2L1-      atgtcatatagtaacagagaactggtggagttctacataagctacaaatt
A0A3Q2QPL9_BCL2L1-      atgtc---tcaaaaccgagaactggtgctgtcctacgtcaagtttaaact
                        *****   *   *** ***********  ** **** * *  *  *** *

A0A3Q2NRP4_BCL2L1-      gtcccagacaaactgtcca-----------aactctctgctgag--gtcc
A0A3Q2QPL9_BCL2L1-      gtctcagaggaactatcccgtcaaccacataatgctcaac-gagccgccc
                        *** ****  **** ***            **  ***  * ***  * **

A0A3Q2NRP4_BCL2L1-      gaggttgctggcgataggaccgagggg---gacaaggactccccggcttc
A0A3Q2QPL9_BCL2L1-      agcgacggcggcgccagggacgcagagtctgacgaggagcagacggcgga
                           *  *  ****  ***  **  * *   *** ****     ****   

A0A3Q2NRP4_BCL2L1-      tagcaatggccctctggtcagcagctgggcc------ggctccccgtggc
A0A3Q2QPL9_BCL2L1-      gacgcacgccaacgggaccgtcaacgggaccagctcgggctccccgcggc
                         *   * * *     *  *  ** * ** **      ********* ***

A0A3Q2NRP4_BCL2L1-      agccttgg--------gcccctcatggccgcg-cggaggctgtgaagtcg
A0A3Q2QPL9_BCL2L1-      ggcggcagcagcagccggcgtccacggcggcgatggaggcggtgaaggtg
                         **    *        * *   ** *** ***  ****** ******  *

A0A3Q2NRP4_BCL2L1-      gctctgagggactcggcggatgagtttgaacatctcttcacccaaagttt
A0A3Q2QPL9_BCL2L1-      gcgctgcgggagacggcctgcgagttcgagctgcgctacgcccgcgcctt
                        ** *** ****  ****    ***** ** *  * ** * ***     **

A0A3Q2NRP4_BCL2L1-      cagtcacctctccctgca-gctggacatcacccccgacacggcctaccac
A0A3Q2QPL9_BCL2L1-      caacgacct-gcacagcacgctgcacatcacgccggccaccgcctaccag
                        **   ****  * * *** **** ******* ** * *** ******** 

A0A3Q2NRP4_BCL2L1-      agcttcaaggccgtgctggacgagttgttcaaggacggggtcaactgggg
A0A3Q2QPL9_BCL2L1-      agcttcgagaacgtgatgaacgaggtgttccgggacggcgtcaactgggg
                        ****** **  **** ** ***** *****  ****** ***********

A0A3Q2NRP4_BCL2L1-      gcgcgtggtggggctgtttgccttcggcggggttctgtgtgtggactgcg
A0A3Q2QPL9_BCL2L1-      ccgcatcgtggggctgttcgcgttcggcggcgcgctctgcgtggagtgcg
                         *** * *********** ** ******** *  ** ** ***** ****

A0A3Q2NRP4_BCL2L1-      tccagaagaacatgagcgagctggtgccccgcatcgcagactggatgacc
A0A3Q2QPL9_BCL2L1-      tggagaaggagatgagtcccctggtgggccgcatcgtggagtggatgacc
                        *  ***** * *****    ******  ********  ** *********

A0A3Q2NRP4_BCL2L1-      atttacctggatgagcagctcgacccctgggtccgcagccaggggggatg
A0A3Q2QPL9_BCL2L1-      gtctacctggacgagcagatcgacccctggatccagagccagggaggatg
                         * ******** ****** *********** ***  ******** *****

A0A3Q2NRP4_BCL2L1-      ggaatgctttgctaagctgtacggccaggacgccgccgcagcgggccgga
A0A3Q2QPL9_BCL2L1-      ggagcgctttgctgaaatctttgggggcaacgcagcggcggagagcagaa
                        ***  ******** *  * *  **     **** ** ** * * ** * *

A0A3Q2NRP4_BCL2L1-      ggtttcaggagacgttgaacaaatggctgctagtcggcgcggctctgcta
A0A3Q2QPL9_BCL2L1-      ggtctcaggagagcttcaagaactggctgctgctggggatgagcgtggtg
                        *** ********  ** ** ** ********  * **   *    ** * 

A0A3Q2NRP4_BCL2L1-      accggatttctgctcgtcgtgctcttcgccaagaaacg---atga
A0A3Q2QPL9_BCL2L1-      acggccttcatagccggctccatcttcgtccagaaacgcctgtga
                        ** *  **  *   ** *    ****** * *******    ***

© 1998-2022Legal notice