Dataset for CDS BCL-2-like of organism Ornithorhynchus anatinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6S8G3_BCL2A1-01        atgg---------------acgacggtgtattctggtccgtc--------
F7G6M3_BCL2L2-01        atggc----------------------------gaccccggcc-------
A0A6I8PIR3_BCL2L1-      atgtc---tctgcggaactacgacctggtgagagacttcgtctcctac--
A0A6I8NSR7_MCL1-01      atgctgggcctgcagaagaacgcc---gtcatcggcctcaacctctactg
A0A6I8NSR7_MCL1-02      atgctgggcctgcagaagaacgcc---gtcatcggcctcaacctctactg
                        ***                                   *  *        

F6S8G3_BCL2A1-01        --------cgagccctggctctgg------actatctggatgacgtcc--
F7G6M3_BCL2L2-01        --------ccggcctcggtctcag-------acacccggg----ccctgg
A0A6I8PIR3_BCL2L1-      -----aagctggcc-cagcgcggg------cacgactgga----gccggc
A0A6I8NSR7_MCL1-01      cgggggcgccggcagcggcgcgggggcctccccgcccggagggcgcctgc
A0A6I8NSR7_MCL1-02      cgggggcgccggcagcggcgcgggggcctccccgcccggagggcgcctgc
                                *  **    *     *           * **       *   

F6S8G3_BCL2A1-01        -------------------------------tccagacgccgcgact---
F7G6M3_BCL2L2-01        tggcggactttgtgg----------------gctacaagctgcggcagaa
A0A6I8PIR3_BCL2L1-      tggtcgacccggaggc---------------cccggacacgggggccgag
A0A6I8NSR7_MCL1-01      ggcccgacaaggcggcggcggtcggcgagggcccggcggcggcggcggcg
A0A6I8NSR7_MCL1-02      ggcccgacaaggcggcggcggtcggcgagggcccggcggcggcggcggcg
                                                        *      * * * *    

F6S8G3_BCL2A1-01        ------------------------------tgggacg-------------
F7G6M3_BCL2L2-01        gggcttcgcctgc-----------------ggggccg-------------
A0A6I8PIR3_BCL2L1-      ggggccg--------------------aggggggccg-------------
A0A6I8NSR7_MCL1-01      gcggcggcccggcgcgcgggcgggggaggggaggccgcggcgccgctgat
A0A6I8NSR7_MCL1-02      gcggcggcccggcgcgcgggcgggggaggggaggccgcggcgccgctgat
                                                        ** **             

F6S8G3_BCL2A1-01        -gtc-------ccaagcagaacttctcgggcgctgcaaaacg--------
F7G6M3_BCL2L2-01        -ggc-------ccggggagggccccccggc-ccagc--------------
A0A6I8PIR3_BCL2L1-      -ggcgg-----------------ccccggcggcggc------ggaggac-
A0A6I8NSR7_MCL1-01      tggcggaggcgccggcgcgagcccctcggcggcggccggcctgggggtcg
A0A6I8NSR7_MCL1-02      tggcggaggcgccggcgcgagcccctcggcggcggccggcctgggggtcg
                         * *                    * ***   * **              

F6S8G3_BCL2A1-01        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
A0A6I8PIR3_BCL2L1-      -----------------gacgacgagg-----------------------
A0A6I8NSR7_MCL1-01      cgcgcccggcccccattggcgccgagggccctgacgtcatcgggaccctc
A0A6I8NSR7_MCL1-02      cgcgcccggcccccattggcgccgagggccctgacgtcatcgggaccctc
                                                                          

F6S8G3_BCL2A1-01        ----tcatgttctcggt----ccagggggac-------------------
F7G6M3_BCL2L2-01        ----ccctgcaccgggc----catgcgggcc-------------------
A0A6I8PIR3_BCL2L1-      ----ccgtgaggcggac----cctgagggag-------------------
A0A6I8NSR7_MCL1-01      gcgcccgcccggcgcgcgccgcctgaggggacggagccgccgccgccgtc
A0A6I8NSR7_MCL1-02      gcgcccgcccggcgcgcgccgcctgaggggacggagccgccgccgccgtc
                             *               *  * ***                     

F6S8G3_BCL2A1-01        -------------------------------gtggagaaggctctgaagc
F7G6M3_BCL2L2-01        -------------------------------gccggggacgagttcgagt
A0A6I8PIR3_BCL2L1-      -------------------------------gccggggacgagttcgagg
A0A6I8NSR7_MCL1-01      ggccgccgccgccgccgccgccctcctccgccccgaggacgaactggacg
A0A6I8NSR7_MCL1-02      ggccgccgccgccgccgccgccctcctccgccccgaggacgaactggacg
                                                          * * * *   *  *  

F6S8G3_BCL2A1-01        ----------------------cgtgcttc----------gacagtctcg
F7G6M3_BCL2L2-01        ----------------------cacgcttccggc-----gggccttctcg
A0A6I8PIR3_BCL2L1-      ----------tgaggtaccgg-cgggcgttcagc----------------
A0A6I8NSR7_MCL1-01      gctacgagcccgaggccccggccaaacgtccggcccacctggccgtgctg
A0A6I8NSR7_MCL1-02      gctacgagcccgaggccccggccaaacgtccggcccacctggccgtgctg
                                              *   * *                     

F6S8G3_BCL2A1-01        acgttggctcggta------------------------------------
F7G6M3_BCL2L2-01        gacttggcgtcccag------------ctgcacgtgacgccc--------
A0A6I8PIR3_BCL2L1-      gacctggcctggcag------------ctgcacatcaccccg--------
A0A6I8NSR7_MCL1-01      gacctgcccggccaggccggcggctccctgccctccacgccgccgcccga
A0A6I8NSR7_MCL1-02      gacctgcccggccaggccggcggctccctgccctccacgccgccgcccga
                            ** *     *                                    

F6S8G3_BCL2A1-01        -----ggggcagccag------------------------aagaatctt-
F7G6M3_BCL2L2-01        -----ggctcggccca------------------------gcagcgctt-
A0A6I8PIR3_BCL2L1-      -----gccacggccta------------------------ccagagctt-
A0A6I8NSR7_MCL1-01      cgaccgcgacgacatggcggacgggctgtaccgccagtccctggagctca
A0A6I8NSR7_MCL1-02      cgaccgcgacgacatggcggacgggctgtaccgccagtccctggagctca
                             *   *  *                                 **  

F6S8G3_BCL2A1-01        ----------------cggccaaattgtggaa------aaggag------
F7G6M3_BCL2L2-01        ----------------cacccaggtgtcg---------gacgagctc---
A0A6I8PIR3_BCL2L1-      ----------------cgagcaggtggtc---------aacgagctc---
A0A6I8NSR7_MCL1-01      tcacccactacctccgcgagcaggcggccggacggaaggacgagccccgg
A0A6I8NSR7_MCL1-02      tcacccactacctccgcgagcaggcggccggacggaaggacgagccccgg
                                        *   **                 * ***      

F6S8G3_BCL2A1-01        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
A0A6I8PIR3_BCL2L1-      --------------------------------------------------
A0A6I8NSR7_MCL1-01      ggccgggaccgccgggcgctggagaccctgaggagggtgggcgacggcat
A0A6I8NSR7_MCL1-02      ggccgggaccgccgggcgctggagaccctgaggagggtgggcgacggcat
                                                                          

F6S8G3_BCL2A1-01        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
A0A6I8PIR3_BCL2L1-      --------------------------------------------------
A0A6I8NSR7_MCL1-01      ccagcgcaaccacgagaccgccttccagggtgagggaggcctccggcgca
A0A6I8NSR7_MCL1-02      ccagcgcaaccacgagaccgccttccag----------------------
                                                                          

F6S8G3_BCL2A1-01        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
A0A6I8PIR3_BCL2L1-      --------------------------------------------------
A0A6I8NSR7_MCL1-01      tgcgcgaagcgggcgcgcccctccccccccctccgtcctacgtactgagc
A0A6I8NSR7_MCL1-02      --------------------------------------------------
                                                                          

F6S8G3_BCL2A1-01        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
A0A6I8PIR3_BCL2L1-      --------------------------------------------------
A0A6I8NSR7_MCL1-01      gccctcccggagcctaatggcacccctccccccccccccgtcccctctcc
A0A6I8NSR7_MCL1-02      --------------------------------------------------
                                                                          

F6S8G3_BCL2A1-01        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
A0A6I8PIR3_BCL2L1-      --------------------------------------------------
A0A6I8NSR7_MCL1-01      ccgcaggcatgctccgcaagctggacatccagaaggaggaggacctgaag
A0A6I8NSR7_MCL1-02      -----ggcatgctccgcaagctggacatccagaaggaggaggacctgaag
                                                                          

F6S8G3_BCL2A1-01        ------ttcgaggacggcatcgtc---------------------aactg
F7G6M3_BCL2L2-01        ------ttccagggggggccc------------------------aactg
A0A6I8PIR3_BCL2L1-      ------ttccgcgacggcgtc------------------------aactg
A0A6I8NSR7_MCL1-01      gccgtgtcccgcgtcggcacccacgttttcaacgacgggacgacgaactg
A0A6I8NSR7_MCL1-02      gccgtgtcccgcgtcggcacccacgttttcaacgacgggacgacgaactg
                              * *   *  **   *                        *****

F6S8G3_BCL2A1-01        ggggcggattgtgacgatatttgtcttggggg--------gcattctcac
F7G6M3_BCL2L2-01        gggccggctggtggccttcttcgtgttcggggcc------gcgctctgcg
A0A6I8PIR3_BCL2L1-      gggccgcgtggtggccttcttcgccttcgg------cggggccctctgcg
A0A6I8NSR7_MCL1-01      gggccgcatcgtgacgctcatctctttcggcgccttcgtggccaagcact
A0A6I8NSR7_MCL1-02      gggccgcatcgtgacgctcatctctttcggcgccttcgtggccaagcact
                        *** **  * *** *  *  *    ** **          **        

F6S8G3_BCL2A1-01        caagaagctccaa--aggag-----cggagtcccgctgacgagagagact
F7G6M3_BCL2L2-01        ccgagagcgtcaacaaggag------atggagcccctggtggggcaggtg
A0A6I8PIR3_BCL2L1-      tggagagcgccgacaaggag------atgggccccctcgtcggacgcgtc
A0A6I8NSR7_MCL1-01      tgaagagcatcaaccaggagggctgcatcgaccccctggccgagagcatc
A0A6I8NSR7_MCL1-02      tgaagagcatcaaccaggagggctgcatcgaccccctggccgagagcatc
                             ***  * *  *****         *  ** **             

F6S8G3_BCL2A1-01        cgggaggagatttcttgtttcatcgcggagttcaccacccaccacgccgg
F7G6M3_BCL2L2-01        ---cagg---------actggatggtggcctacctggacacccagctggc
A0A6I8PIR3_BCL2L1-      ---ggga---------gctggatggccacctacctcgaccgccgcctcga
A0A6I8NSR7_MCL1-01      acggagg---------tcctggtgaccaccaagagggactggctggtcaa
A0A6I8NSR7_MCL1-02      acggagg---------tcctggtgaccaccaagagggactggctggtcaa
                             *                *               *   *       

F6S8G3_BCL2A1-01        agagtggataaggcagaacggaggctgggaaa-----atggattttta--
F7G6M3_BCL2L2-01        cgactggatccgcagcagcgggggctgggcggagttcacggccctgtacg
A0A6I8PIR3_BCL2L1-      cccctggatccgagacaacggaggctgggacacgttcgtggagctctacg
A0A6I8NSR7_MCL1-01      ac---------------agaaaggctgggaaggatttgtggaattct---
A0A6I8NSR7_MCL1-02      ac---------------agaaaggctgggaaggatttgtggaattct---
                                              *******          **   * *   

F6S8G3_BCL2A1-01        --------------------------------aataagtttgaacaaaag
F7G6M3_BCL2L2-01        gggacggggccctggaggacgcccggcgcctgcgggagggcaactgggcc
A0A6I8PIR3_BCL2L1-      gcaacgacgc------ggccgcccagagc---cggaaggaccaagaacgc
A0A6I8NSR7_MCL1-01      ---tccacgt------gg------------------aggacatggaaggc
A0A6I8NSR7_MCL1-02      ---tccacgt------gg------------------aggacatggaaggc
                                                            **            

F6S8G3_BCL2A1-01        accgtctggtcggtgttagcggatatttcgatgaagatcttgggcgtact
F7G6M3_BCL2L2-01        tccgtccggaccgtgctgacgggggccgtggcgc------tgggagccct
A0A6I8PIR3_BCL2L1-      ttcaaccgctggctgctcaccggcctcaccgtgg------ccgccgtcct
A0A6I8NSR7_MCL1-01      agcgtccggaacgtgctcctgctcttcgccgggg------tggccagcct
A0A6I8NSR7_MCL1-02      agcgtccggaacgtgctcctgctcttcgccgggg------tggccagcct
                          *  * *     ** *               *         *     **

F6S8G3_BCL2A1-01        --ctcccacctgaagcaattttac-------tga----------------
F7G6M3_BCL2L2-01        ggtgaccgtcggggccttcttcgcgagcaagtga----------------
A0A6I8PIR3_BCL2L1-      gctgctcggctc--cctg-ttcacccgcaagtga----------------
A0A6I8NSR7_MCL1-01      gggagccggcttggccta-tctaat--aagatgatggggggacccccccc
A0A6I8NSR7_MCL1-02      gggagccggcttggccta-tctaat--aagatga----------------
                              *  *     *   *           ***                

F6S8G3_BCL2A1-01        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
A0A6I8PIR3_BCL2L1-      --------------------------------------------------
A0A6I8NSR7_MCL1-01      cccttccccctcggacgctcagagactgacttcacatcggagcagaccag
A0A6I8NSR7_MCL1-02      --------------------------------------------------
                                                                          

F6S8G3_BCL2A1-01        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
A0A6I8PIR3_BCL2L1-      --------------------------------------------------
A0A6I8NSR7_MCL1-01      ccccaggcgccggccacccgtcggaactgtcgcttctgccgccgggaagc
A0A6I8NSR7_MCL1-02      --------------------------------------------------
                                                                          

F6S8G3_BCL2A1-01        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
A0A6I8PIR3_BCL2L1-      --------------------------------------------------
A0A6I8NSR7_MCL1-01      tttatttatgaagcccagcgtccagccgcccagaattggcaccgacaggc
A0A6I8NSR7_MCL1-02      --------------------------------------------------
                                                                          

F6S8G3_BCL2A1-01        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
A0A6I8PIR3_BCL2L1-      --------------------------------------------------
A0A6I8NSR7_MCL1-01      accgagcggcggcccagccaggcaagagggtttgggctggtttggggacg
A0A6I8NSR7_MCL1-02      --------------------------------------------------
                                                                          

F6S8G3_BCL2A1-01        --------
F7G6M3_BCL2L2-01        --------
A0A6I8PIR3_BCL2L1-      --------
A0A6I8NSR7_MCL1-01      gatattaa
A0A6I8NSR7_MCL1-02      --------
                                

© 1998-2022Legal notice