Dataset for CDS Unclassified of organism Cyprinus carpio carpio

[Download (right click)]

8 sequence(s)

>gnl|bcl2dbcds|A0A8C1C3R5_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio carpio (length=516 residues).
ttcctcacaccagccaatgtgtatgataaccgcagtatagtggagaagtacatccaccataagctctggaagaaggggta
cgtgtgggaagaggaccgcggcggcacccgtcacgacccgtgcagcgcgcttcataaggtgctgcgggaggccggggacg
agctggagcggctttatcagtcggactttgcggagatgtccaaacagctgcatctcacgtccatcacggcgcagcagcgc
tttaccgcggtcatagacgagctgttcagggacggcgtgaactggggcagaatcatcgcttttttcgagtttggagggac
cgtttgtgtcgaatgcgtgaataaggagatgacggcgcatgtggataacatcgcgggctggatgaccgagtatctgaatg
ggccgctgcacgcctggatccaggagaacggcggctggcacgggaattttgcaatcctgtgtattttggtggttcggaag
ggttggttggcatgcttttcattttgtgctgagtga
>gnl|bcl2dbcds|A0A8C1C5B5_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio carpio (length=552 residues).
atgcttaaatcctctcttgcatgcctggaattttctgggtacgtgtgggaagtgaacggacacgatgacagcgtctcgaa
tggactgatgatggagaggcaggaggaccgcggcggcacccgtcacgacccgtgcagcgccctccacacggtgctacggg
aggctggggacgagctggagcggctttatcagtcggactttgcggagatgtccaaacagctgcatatcacgtccatcacg
gcgcagcagcgcttcaccgcggtcatagacgagctgttcagggacggcgtgaactggggaagaatcatcgcttttttcga
gtttggagggaccgtttgcgtcgaatgcgtgaataaggagatgacggcgcatgtggataacatcgcgggctggatgaccg
agtatctgaacgggccgctgcacgcctggatccaggagaacggcggctggggtcgctcgctccgcccattctcctgcgtt
cgaagcgttgcgcgtcctctgattgctgaaggcgtggctctcctgtgcacaactttcaggaactgctgttga
>gnl|bcl2dbcds|A0A8C1C5B5_uncBCL2-02 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio carpio (length=486 residues).
cagcgcacgccagcgaggaagtctttccccgcaccagcctacatccaccataagctctggaagaaggggtacgtgtggga
agaggaccgcggcggcacccgtcacgacccgtgcagcgccctccacacggtgctacgggaggctggggacgagctggagc
ggctttatcagtcggactttgcggagatgtccaaacagctgcatatcacgtccatcacggcgcagcagcgcttcaccgcg
gtcatagacgagctgttcagggacggcgtgaactggggaagaatcatcgcttttttcgagtttggagggaccgtttgcgt
cgaatgcgtgaataaggagatgacggcgcatgtggataacatcgcgggctggatgaccgagtatctgaacgggccgcttg
tatcctactcaaatgtgcacgtaatttttttatgcacatttgtagaatttatacgcatgttggcctttccatccagcggt
ttttga
>gnl|bcl2dbcds|A0A8C1C5B5_uncBCL2-03 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio carpio (length=606 residues).
atggagcgactgcgccgagcagacgccacgaaacactcaactcacacacacacacacacacacacaactgttcagctggt
gaagtacatccaccataagctctggaagaaggggtacgtgtgggaaaggcaggaggaccgcggcggcacccgtcacgacc
cgtgcagcgccctccacacggtgctacgggaggctggggacgagctggagcggctttatcagtcggactttgcggagatg
tccaaacagctgcatatcacgtccatcacggcgcagcagcgcttcaccgcggtcatagacgagctgttcagggacggcgt
gaactggggaagaatcatcgcttttttcgagtttggagggaccgtttgcgtcgaatgcgtgaataaggagatgacggcgc
atgtggataacatctgtatcctactcaaatgtgcacgtaatttttttatgcacatttgtagaatttatacgcatgttggc
ctttccatccagcggtttttgatgcgattccaagatgcgcataaaaatcggtggatgacagctgctgtctgcagcagagc
tgaaggcgtggctctcctgtgcacaactttcaggaactgctgttga
>gnl|bcl2dbcds|A0A8C1HXI5_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio carpio (length=663 residues).
atggccaacgaaattcgctatgacaatcggaatattgtggagaaatacctcaatcacaaactttcaaagaagggatatga
gtggaaatttcaatcttccggggaggatgatgacactatcaatacgggagtggaggactcctctccgagctctgacagga
ggctccaggctccctcagccggagggggaaacaactctgaatgcctgatagcaaaccgggtcacacgttcagacccttat
tcgaggatctaccgatcgttacgcgaggctggagaccagatagaaaggatgtaccagcgtgaatttgaggagatgtccca
ccagatgacattcagtcccagtgcagcacaacgcagcttcttagctgtggctgaagagctcttcagagacggagtgaact
gggggcggatcgtcgctttctttgagtttggtgggaccatgtgtgtggagagcttcaaccgggagatggcgtcccaggta
gataatattgcacactggatgacagactacctgaacgggccactggaaaactggatcgaggaaaatggaggctggtgtga
aaagatggatctcaaaatcatacagtcactgctggaaacggttcaaatatgcaaaagatgctggaaaactgaagaatctg
caggacatggaggatttttctga
>gnl|bcl2dbcds|A0A8C1HXI5_uncBCL2-02 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio carpio (length=627 residues).
atggccaacgaaattcgctatgacaatcggaatattgtggagaaatacctcaatcacaaactttcaaagaagggatatga
gtggaaatttcaatcttccggggaggatgatgacactatcaatacgggagtggaggactcctctccgagctctgacagga
ggctccaggctccctcagccggagggggaaacaactctgaatgcctgatagcaaaccgggtcacacgttcagacccttat
tcgaggatctaccgatcgttacgcgaggctggagaccagatagaaaggatgtaccagcgtgaatttgaggagatgtccca
ccagatgacattcagtcccagtgcagcacaacgcagcttcttagctgtggctgaagagctcttcagagacggagtgaact
gggggcggatcgtcgctttctttgagtttggtgggaccatgtgtgtggagagcttcaaccgggagatggcgtcccaggta
gataatattgcacactggatgacagactacctgaacgggccactggaaaactggatcgaggaaaatggaggctgggtaag
tttatggtcagatggtcgtgacctttgcccagttgtttattactgcatttctgcagttgaagcttga
>gnl|bcl2dbcds|A0A8C1HXI5_uncBCL2-03 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio carpio (length=627 residues).
atggccaacgaaattcgctatgacaatcggaatattgtggagaaatacctcaatcacaaactttcaaagaagggatatga
gtggaaatttcaatcttccggggaggatgatgacactatcaatacgggagtggaggactcctctccgagctctgacagga
ggctccaggctccctcagccggagggggaaacaactctgaatgcctgatagcaaaccgggtcacacgttcagacccttat
tcgaggatctaccgatcgttacgcgaggctggagaccagatagaaaggatgtaccagcgtgaatttgaggagatgtccca
ccagatgacattcagtcccagtgcagcacaacgcagcttcttagctgtggctgaagagctcttcagagacggagtgaact
gggggcggatcgtcgctttctttgagtttggtgggaccatgtgtgtggagagcttcaaccgggagatggcgtcccaggta
gataatattgcacactggatgacagactacctgaacgggccactggaaaactggatcgaggaaaatggaggctgggtaag
tttatggtcagatggtcgtgacctttgcccagttgtttattactgcatttctgcagttgaagcttga
>gnl|bcl2dbcds|A0A9J7YDU0_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio carpio (length=639 residues).
atggccaacgaaattcgctttgacaatcggaatattgtggagaaatacatcaatatcaaactttcaaagaagggatatgt
gtggaaatctcaatcttctggggaggacgatgacaccgtcaataaaggagtcgagggctcctctctaaactctgacagga
gactccaggctccctcagccggaggggggaacaactctgaatgcctgatagctcaccgggtcactcgttcagacccttat
tccaggatctaccgggcgctacgcgaggctggagacgagatagaaaggatgtaccagcgtgaatttgaggagatgtccca
ccgcatgatacaacgcaatacaacgcaacgcagcttcttagccgtggcagaagagctctttaaagacggagtgaactggg
ggcggatcatcgctttctttgagtttggtgggaccatgtgtgtggagagcgtcaaccgggagatggcgtcccaggtagat
aatattgcacactggatgacagactacctgaacgggcctctggaaaactggatcgaggaaaatggaggctgggttagact
gactcaaatggcttatgataaagtgaagtacaggaagagcatttcagatgaactgccatacacaaacactctccaggcg
© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice