Dataset for CDS Unclassified of organism Nothobranchius furzeri

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A1A8AM77_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Nothobranchius furzeri (length=672 residues).
atggcgaacgagtggaatcgcaatatcgtggaaaactatatctgccataaactctcaaagagggggttcgcgtggggctt
cgatgacggtgctgtcgccaataacggctcagtgggtgaccgctctccgactgtggtccgcaggtgcagagaggctggat
caccgggccccgatgtggactgcagacggatctcccagcagcccgagccgctcgcggacatccacagggtcatgcgggag
gctggagacgagctggagagactctaccagttggactttacggagatgtcacggcagctgtacctcaccaacgccacggc
caagacccggttcgccgaggtgatagatgaactgttccgggacggggtgaactggggccggattatcgctttcttcgagt
tcgggggcacagtgtgcgtggagtgcgcgtccagagaggagatggcaacgcaggtcgacaccatagcagagtggatgacg
gaatatttaaacggtcctcttcttaacagctggatagaagataacgggggatggggtgcgtttgtggacctgtatgaccg
acagaaggactccgtcttcagctgctactggccgtccatcaagaccgtctttggcctggctgcactcggggcggccagca
tcaccatcggagcgtaccttgcacaaaagtga
© 1998-2021Legal notice