Dataset for CDS BCL-2-like of organism Chinchilla lanigera

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C2YUU6_BCL2L1-      atgtct-----------------caga-----gcaactgggagctggtgg
A0A8C2YUU6_BCL2L1-      atgtct-----------------caga-----gcaactgggagctggtgg
A0A8C2YUU6_BCL2L1-      atgtct-----------------caga-----gcaactgggagctggtgg
A0A8C2UN30_BCL2A1-      atgatt------gaccaggagttcaggt----acacgcaaactctggccc
A0A8C2VKS3_BCL2-01      atggcg----cacgctgggagaacagggtatgataaccgggagatagtga
A0A8C2VJ88_BCL2L2-      atggcgaccccagcct-------cggccccagacacacgggctctggtgg
A0A8C2VJ88_BCL2L2-      atggcgaccccagcct-------cggccccagacacacgggctctggtgg
                        ***                    * *        *         * *   

A0A8C2YUU6_BCL2L1-      ttgactttctctcctaca--------agctttcccagaaaggatacagct
A0A8C2YUU6_BCL2L1-      ttgactttctctcctaca--------agctttcccagaaaggatacagct
A0A8C2YUU6_BCL2L1-      ttgactttctctcctaca--------agctttcccagaaaggatacagct
A0A8C2UN30_BCL2A1-      aggagtacct--gctgcacgtcctgcaggtgccgcag------------t
A0A8C2VKS3_BCL2-01      tgaagtacatccactata--------agctgtcgcagaggggctacgagt
A0A8C2VJ88_BCL2L2-      ctgactttgtaggctata--------agctgaggcagaagggttatgtct
A0A8C2VJ88_BCL2L2-      ctgactttgtaggctata--------agctgaggcagaagggttatgtct
                           * *   *   **  *        ** *    ***            *

A0A8C2YUU6_BCL2L1-      ggagtcagttcagtgatgtggaagagaacaggactgaaggcccagaaggg
A0A8C2YUU6_BCL2L1-      ggagtcagttcagtgatgtggaagagaacaggactgaaggcccagaaggg
A0A8C2YUU6_BCL2L1-      ggagtcagttcagtgatgtggaagagaacaggactgaaggcccagaaggg
A0A8C2UN30_BCL2A1-      gc---------------------------------------------ggg
A0A8C2VKS3_BCL2-01      gg---------------------------------------------gat
A0A8C2VJ88_BCL2L2-      gt---------------------------------------------gga
A0A8C2VJ88_BCL2L2-      gt---------------------------------------------gga
                        *                                              *  

A0A8C2YUU6_BCL2L1-      gctgaatcagagacggagac---ccccagtg------ccatcaatggcaa
A0A8C2YUU6_BCL2L1-      gctgaatcagagacggagac---ccccagtg------ccatcaatggcaa
A0A8C2YUU6_BCL2L1-      gctgaatcagagacggagac---ccccagtg------ccatcaatggcaa
A0A8C2UN30_BCL2A1-      gccag------------------ccccagcaggacgtcca----------
A0A8C2VKS3_BCL2-01      gccggagaggagagcgccgcgccccccggggccgcgcccacgccgggcat
A0A8C2VJ88_BCL2L2-      gctgg------------------ccctgggg-------------------
A0A8C2VJ88_BCL2L2-      gctgg------------------ccctgggg-------------------
                        **                     ***  *                     

A0A8C2YUU6_BCL2L1-      cccatcctggcacctggcggatagccgcacggtgaatggggccactggcc
A0A8C2YUU6_BCL2L1-      cccatcctggcacctggcggatagccgcacggtgaatggggccactggcc
A0A8C2YUU6_BCL2L1-      cccatcctggcacctggcggatagccgcacggtgaatggggccactggcc
A0A8C2UN30_BCL2A1-      ----------------gagtgctac-------------------------
A0A8C2VKS3_BCL2-01      cttctccttccagcccgggcgcaactccccggccgctgcgccccgggacc
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
                                                                          

A0A8C2YUU6_BCL2L1-      acagcagcagtttggatgcccgcgaggtgatc--------cccatggcag
A0A8C2YUU6_BCL2L1-      acagcagcagtttggatgcccgcgaggtgatc--------cccatggcag
A0A8C2YUU6_BCL2L1-      acagcagcagtttggatgcccgcgaggtgatc--------cccatggcag
A0A8C2UN30_BCL2A1-      --------ag-------ggt---gtggctttc-----------------t
A0A8C2VKS3_BCL2-01      cggccgccag-------gacctcgccgccgccgccgctggccggcctcgc
A0A8C2VJ88_BCL2L2-      --------ag-------ggcccagcagctgac-----------------c
A0A8C2VJ88_BCL2L2-      --------ag-------ggcccagcagctgac-----------------c
                                **       *     *  *    *                  

A0A8C2YUU6_BCL2L1-      cagtgaaacaagctctgagggag---------------------------
A0A8C2YUU6_BCL2L1-      cagtgaaacaagctctgagggag---------------------------
A0A8C2YUU6_BCL2L1-      cagtgaaacaagctctgagggag---------------------------
A0A8C2UN30_BCL2A1-      cagtgcagaaaga-------------------------------------
A0A8C2VKS3_BCL2-01      cgccgccgcgggacctgcgctcagcccggtgccacctgtggtccacctga
A0A8C2VJ88_BCL2L2-      cactgcaccaagccatgcgggca---------------------------
A0A8C2VJ88_BCL2L2-      cactgcaccaagccatgcgggca---------------------------
                        *   *      *                                      

A0A8C2YUU6_BCL2L1-      -----------gcgggcgacgagtttgaactgcggtaccggcgagcattc
A0A8C2YUU6_BCL2L1-      -----------gcgggcgacgagtttgaactgcggtaccggcgagcattc
A0A8C2YUU6_BCL2L1-      -----------gcgggcgacgagtttgaactgcggtaccggcgagcattc
A0A8C2UN30_BCL2A1-      -----------agtggaggagag-------cctgaagccg----------
A0A8C2VKS3_BCL2-01      ccctccgccaggccggcgacgacttctcccgtcgctaccgccgcgacttc
A0A8C2VJ88_BCL2L2-      -----------gctggagatgagttcgagacccggttccggcgcaccttc
A0A8C2VJ88_BCL2L2-      -----------gctggagatgagttcgagacccggttccggcgcaccttc
                                      ** *  **           *   ***          

A0A8C2YUU6_BCL2L1-      agtgacctaacatctcagctac-acatcaccccgggga---cagcatatc
A0A8C2YUU6_BCL2L1-      agtgacctaacatctcagctac-acatcaccccgggga---cagcatatc
A0A8C2YUU6_BCL2L1-      agtgacctaacatctcagctac-acatcaccccgggga---cagcatatc
A0A8C2UN30_BCL2A1-      -------tggttggacagatgcgatgtggcgtccgtcaacgctgccaggg
A0A8C2VKS3_BCL2-01      gccgagatgtccagccagctgc-acctgacgcccttca---ccgcgaggg
A0A8C2VJ88_BCL2L2-      tcagatctggctgctcagctgc-atgtgacccctggct---cagcccagc
A0A8C2VJ88_BCL2L2-      tcagatctggctgctcagctgc-atgtgacccctggct---cagcccagc
                               *       *** * * *  *  *  *        * **     

A0A8C2YUU6_BCL2L1-      agagctttgaacaggtagtgaatgaactcttccgggatggggta---aac
A0A8C2YUU6_BCL2L1-      agagctttgaacaggtagtgaatgaactcttccgggatggggta---aac
A0A8C2YUU6_BCL2L1-      agagctttgaacaggtagtgaatgaactcttccgggatggggta---aac
A0A8C2UN30_BCL2A1-      cgatattcacccaggtgatggagaaggagttcgaggacggcatcattaac
A0A8C2VKS3_BCL2-01      gacgctttgccacggtggtggaggagctcttcagggatggggtg---aac
A0A8C2VJ88_BCL2L2-      agcgcttcacccaggtctccgacgaacttttccaagggggcccc---aac
A0A8C2VJ88_BCL2L2-      agcgcttcacccaggtctccgacgaacttttccaagggggcccc---aac
                             **      ***     *  *    ***   *  **       ***

A0A8C2YUU6_BCL2L1-      tggggtcgcattgtggcctttttctccttcggcggggcattgtgcgtg--
A0A8C2YUU6_BCL2L1-      tggggtcgcattgtggcctttttctccttcggcggggcattgtgcgtg--
A0A8C2YUU6_BCL2L1-      tggggtcgcattgtggcctttttctccttcggcggggcattgtgcgtg--
A0A8C2UN30_BCL2A1-      tgggggcggattgtgaccatatttgcttttgggggagtcatcctcaagaa
A0A8C2VKS3_BCL2-01      tgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtg--
A0A8C2VJ88_BCL2L2-      tggggccgtcttgtggccttctttgtctttggggctgccctgtgtgct--
A0A8C2VJ88_BCL2L2-      tggggccgtcttgtggccttctttgtctttggggctgccctgtgtgct--
                        *****  *  ***** ** * **    ** ** *  *   *         

A0A8C2YUU6_BCL2L1-      --------gagagcgtagacaaggagatgcaggtattggtgaggcggatc
A0A8C2YUU6_BCL2L1-      --------gagagcgtagacaaggagatgcaggtattggtgaggcggatc
A0A8C2YUU6_BCL2L1-      --------gagagcgtagacaaggagatgcaggtattggtgaggcggatc
A0A8C2UN30_BCL2A1-      acttccgcgagagccgctggccccagatgtggacacttacagg-gagatt
A0A8C2VKS3_BCL2-01      --------gagagcgtcaaccgggagatgtcgcccctggtggacaacatc
A0A8C2VJ88_BCL2L2-      --------gagagtgtcaacaaagagatggaaccactggtgggccaagtg
A0A8C2VJ88_BCL2L2-      --------gagagtgtcaacaaagagatggaaccactggtgggccaagtg
                                *****           *****       *           * 

A0A8C2YUU6_BCL2L1-      gcaagctggatggccacttacctgaatgaccacctagagccttggatcca
A0A8C2YUU6_BCL2L1-      gcaagctggatggccacttacctgaatgaccacctagagccttggatcca
A0A8C2YUU6_BCL2L1-      gcaagctggatggccacttacctgaatgaccacctagagccttggatcca
A0A8C2UN30_BCL2A1-      tctcactttgtggctgagttcgtagtgaaccacacgggagactggatccg
A0A8C2VKS3_BCL2-01      gccctctggatgacagagtacctgaaccggcacctgcacacctggatcca
A0A8C2VJ88_BCL2L2-      caggagtggatggtggcctacctggagacgcgcctggccgactggatcca
A0A8C2VJ88_BCL2L2-      caggagtggatggtggcctacctggagacgcgcctggccgactggatcca
                              *   **      * * *       * *         ******* 

A0A8C2YUU6_BCL2L1-      ggagaacggcggctgggatacgtttgtggaactctacgggaacaatgca-
A0A8C2YUU6_BCL2L1-      ggagaacggcggctgggatacgtttgtggaactctacgggaacaatgca-
A0A8C2YUU6_BCL2L1-      ggagaacggcggctgggatacgtttgtggaactctacgggaacaatgca-
A0A8C2UN30_BCL2A1-      gcagaacggaggctgggaaa-----acggctttgtgagga----------
A0A8C2VKS3_BCL2-01      agataacggaggctgggacgcctttgtggagctgtatggacccag-----
A0A8C2VJ88_BCL2L2-      cagcagtgggggctgggcggagttcacagctctatacggggacggggccc
A0A8C2VJ88_BCL2L2-      cagcagtgggggctggcc-----------ctctgca--------------
                            *  ** ******                *                 

A0A8C2YUU6_BCL2L1-      ----------gcagccgagagccggaagggccaggagcgcttcaaccgct
A0A8C2YUU6_BCL2L1-      ----------gcagccgagagccggaagggccaggagcgcttcaaccgct
A0A8C2YUU6_BCL2L1-      ----------gcagccgagagccggaagggccaggagcgcttcaaccgct
A0A8C2UN30_BCL2A1-      ------------agtttgagcccaaatttggctggctgaccttcgtggga
A0A8C2VKS3_BCL2-01      -------tgtacggcctctgtttgacttctcctggctgtctctgaagact
A0A8C2VJ88_BCL2L2-      tggaggaggcgcggcgtctgcgggaggggaactgggcatcagtgaggaca
A0A8C2VJ88_BCL2L2-      ----------------------------aagctgatctccagggggaa--
                                                       * *     *          

A0A8C2YUU6_BCL2L1-      ggttcctgacaggca-tgaccgtggccggcgtggttctgctggggtcgct
A0A8C2YUU6_BCL2L1-      ggttcctgacaggca-tgaccgtggccggcgtggttctgctggggtcgct
A0A8C2YUU6_BCL2L1-      ggttcctgacaggca-tgaccgtggccggcgtggttctgctggggtcgct
A0A8C2UN30_BCL2A1-      gttctgggacagatc-------tgtgagatgctgtccctcctgaagcaat
A0A8C2VKS3_BCL2-01      ctgctcagcctggccctgg---tgggagcctgcatcacgctgggtgccta
A0A8C2VJ88_BCL2L2-      gtgctgacgggggctgtggcactgggggccctggtaactgtaggggcctt
A0A8C2VJ88_BCL2L2-      -----gatgggggctctg--attggcagctgggacagctg----------
                                   *          **   *                      

A0A8C2YUU6_BCL2L1-      cttcagtcggaaatga
A0A8C2YUU6_BCL2L1-      cttcagtcggaaatga
A0A8C2YUU6_BCL2L1-      cttcagtcggaaatga
A0A8C2UN30_BCL2A1-      tct--------actga
A0A8C2VKS3_BCL2-01      cctgggacacaagtga
A0A8C2VJ88_BCL2L2-      ttttgctagcaagtga
A0A8C2VJ88_BCL2L2-      ---tgctaggaaggag
                                   *    

© 1998-2022Legal notice