Dataset for CDS BCL-2-like of organism Castor canadensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A250YD48_BCL2L1-      atgtc----tcag-----------------agcaaccgggagctggtggt
A0A250YBR2_BCL2L2-      atggcgaccccagcctcggcccca------gacacacgggctctggtggc
A0A250YBR2_BCL2L2-      atggcgaccccagcctcggcccca------gacacacgggctctggtggc
A0A250YD83_BCL2-01      atggcg---caagctgggagaacagggtatgataaccgggagatagtgat
                        *** *      **                    *  ****   * ***  

A0A250YD48_BCL2L1-      tgactttctctcctacaagctttcccagaaaggatacagctggagtcagt
A0A250YBR2_BCL2L2-      tgactttgtaggctataagctgaggcagaagggttatgtctgt-------
A0A250YBR2_BCL2L2-      tgactttgtaggctataagctgaggcagaagggttatgtctgt-------
A0A250YD83_BCL2-01      gaaatacatccactataagctgtcacagaggggctacgagtgg-------
                          * *   *   *** *****    ****  ** **    **        

A0A250YD48_BCL2L1-      ttagtgatgtggaagagaataggactgaggccccagaagggattgaatca
A0A250YBR2_BCL2L2-      -----ggagctgg-----------------ccctggag------------
A0A250YBR2_BCL2L2-      -----ggagctgg-----------------ccctggag------------
A0A250YD83_BCL2-01      -----gatgccggagacgtgggcgccgcgcccccggaggccaccccagcg
                             *  *  *                  ***  **             

A0A250YD48_BCL2L1-      gaggtggagacccccagtgccatcaatggcaacc------------catc
A0A250YBR2_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
A0A250YD83_BCL2-01      ccgggcatcttctccttccagcccgggagcaaccccctgcccgctgcgcc

A0A250YD48_BCL2L1-      ctggcacctggtggacagccccgcagtgaatggagccactggccacagca
A0A250YBR2_BCL2L2-      ----------------agggcc-cagctgctg------------------
A0A250YBR2_BCL2L2-      ----------------agggcc-cagctgctg------------------
A0A250YD83_BCL2-01      ccgggaccgggccgccaggacc-acgtcgctgccgcccccggtcgccccc
                                        **  **   *    **                  

A0A250YD48_BCL2L1-      gcagtttg-gatgcccgggaggtgatccccatgacagcagtga---agca
A0A250YBR2_BCL2L2-      -----------------------------------acccgt--tacacca
A0A250YBR2_BCL2L2-      -----------------------------------acccgt--tacacca
A0A250YD83_BCL2-01      gccgcccgcgccgggcctgcgctcagcccagtaccacctgtggtccacct
                                                           * * **     * * 

A0A250YD48_BCL2L1-      agcgctgagggaggcaggtgacgagtttgaactgcggtaccggcgggcat
A0A250YBR2_BCL2L2-      agccatgcgggcagctggagatgagtttgagacccgcttccggcgcacat
A0A250YBR2_BCL2L2-      agccatgcgggcagctggagatgagtttgagacccgcttccggcgcacat
A0A250YD83_BCL2-01      gaccctccgccaggctggcgatgacttctcccggcgctaccgccgcgact
                          *  *  *    ** ** ** ** **       ** * *** **    *

A0A250YD48_BCL2L1-      tcagtgacctgacatcccagctccacataaccccggggacagcatatcag
A0A250YBR2_BCL2L2-      tctctgatctggcggctcagctacatgtgaccccaggctcagcccagcaa
A0A250YBR2_BCL2L2-      tctctgatctggcggctcagctacatgtgaccccaggctcagcccagcaa
A0A250YD83_BCL2-01      tcgccgagatgtccagccagctgcacctgacgcccttcaccgcgagggga
                        **   **  ** *    ***** **  * ** **     * **       

A0A250YD48_BCL2L1-      agctttgaacaggtagtgaacgaactcttccgggatggggtaaactgggg
A0A250YBR2_BCL2L2-      cgcttcacccaggtctctgatgaacttttccaagggggccccaactgggg
A0A250YBR2_BCL2L2-      cgcttcacccaggtctctgatgaacttttccaagggggccccaactgggg
A0A250YD83_BCL2-01      cgctttgccacggtggtggaggagctcttcagggatggggtgaactgggg
                         ****      ***     * ** ** ***   *  **    ********

A0A250YD48_BCL2L1-      tcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcg
A0A250YBR2_BCL2L2-      ccgtcttgtggccttctttgtctttggggctgccctgtgtgctgagagca
A0A250YBR2_BCL2L2-      ccgtcttgtggccttctttgtctttggggctgccctgtgtgctgagagca
A0A250YD83_BCL2-01      gaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcg
                          *  ********** **    ** ** *  *   **** *  ** *** 

A0A250YD48_BCL2L1-      tagacaaggagatgcaggtattggtgagtcggatcgcaagttggatggct
A0A250YBR2_BCL2L2-      tcaacaaagagatggaaccactggtgggacaagtacaggagtggatggtg
A0A250YBR2_BCL2L2-      tcaacaaagagatggaaccactggtgggacaagtacaggagtggatggtg
A0A250YD83_BCL2-01      tcaaccgggagatgtcgcctctggtggacaacatcgccttgtggatgatt
                        *  **   ******       *****       *       ******   

A0A250YD48_BCL2L1-      acttacctgaatgaccacctagaaccttggatccaggagaacggcggctg
A0A250YBR2_BCL2L2-      gcctacctggagacacgcctagccgactggatccacagcagtgggggctg
A0A250YBR2_BCL2L2-      gcctacctggagacacgcctagccgactggatccacagcagtgggggctg
A0A250YD83_BCL2-01      gagtacctgaaccggcacctgcacacctggatccaggataacggaggctg
                           ****** *    * ***       ********    *  ** *****

A0A250YD48_BCL2L1-      ggacacttttgtggaactctatggaaacaatgcagcagccgagagccgga
A0A250YBR2_BCL2L2-      ggcggagttcacagctctgtacggggacggggccctggaggaggcgcggc
A0A250YBR2_BCL2L2-      ggcggagttcacagctctgtacggggacggggccctggaggaggcgcggc
A0A250YD83_BCL2-01      ggatgcctttgtggaactgtat--------ggccccag----tgtgcgac
                        **     **    *  ** **          **    *        **  

A0A250YD48_BCL2L1-      agggccaggagcgcttcaaccgctggttcctgacaggcatgactgtggct
A0A250YBR2_BCL2L2-      ---gcctgcgggaggggaactgggcatcagtga-ggacagtgctgacggg
A0A250YBR2_BCL2L2-      ---gcctgcgggaggggaactgggcatcagtga-ggacagtgctgacggg
A0A250YD83_BCL2-01      ---ctctgtttgacttctcctggctgtctctga-agactctgctcagcct
                             * *           * *    *   ***  * *    **      

A0A250YD48_BCL2L1-      ggc-gtggttctg---------------ctgggctcgctcttcagtcgga
A0A250YBR2_BCL2L2-      ggctgtggcactgggggccctggtaactgtaggggccttttttgctagca
A0A250YBR2_BCL2L2-      ggctgtggcactgggggccctggtaactgtaggggccttttttgctagca
A0A250YD83_BCL2-01      ggccctgg---tgggagtctgtatcaccctgggtgcctacctgggccaca
                        ***  ***   **                * **  *     *       *

A0A250YD48_BCL2L1-      aatga
A0A250YBR2_BCL2L2-      agtga
A0A250YBR2_BCL2L2-      agtga
A0A250YD83_BCL2-01      agtga
                        * ***

© 1998-2020Legal notice