Dataset for CDS BCL-2-like of organism Castor canadensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A250YD48_BCL2L1-      atg----------------------------------tctcagagcaacc
A0A250YD83_BCL2-01      atggcgcaagctgggagaa----------------cagggtatgataacc
A0A8C0WAG3_BCL2A1-      atg---tgcccca--------------------ctcccgccaagctcggc
A0A8C0XBQ2_BCL2L10      atg-gcggacccg-------------------------------ctgcgg
A0A250YBR2_BCL2L2-      atg-gcgacccca------------------gcctcggccccagacacac
A0A250YBR2_BCL2L2-      atg-gcgacccca------------------gcctcggccccagacacac
A0A8C0WJK2_MCL1-01      atgtttggcctcaagagaaacgcggtaatcggactcaacctctactgtgg
                        ***                                               

A0A250YD48_BCL2L1-      gggagctggtggttgactttctctcctacaagctttccc-----------
A0A250YD83_BCL2-01      gggagatagtgatgaaatacatccactataagctgtcac-----------
A0A8C0WAG3_BCL2A1-      gagccct----------------ggcttcagtccgccgc------agctg
A0A8C0XBQ2_BCL2L10      gagcgcaccgagc----------ggctgctgaccga--------------
A0A250YBR2_BCL2L2-      gggctctggtggctgactttgtaggctataagctgaggc-----------
A0A250YBR2_BCL2L2-      gggctctggtggctgactttgtaggctataagctgaggc-----------
A0A8C0WJK2_MCL1-01      gggtgctg--ggctgg------gggccggtagcggcggcgccaccacccc
                        * *                      *      *                 

A0A250YD48_BCL2L1-      ------agaaaggatac--------agctggagtcagtttagtgatgtgg
A0A250YD83_BCL2-01      ------agaggggctacgagtgggatgccggag-----------------
A0A8C0WAG3_BCL2A1-      ccccggtgagcggctgc--------agcccgc------------------
A0A8C0XBQ2_BCL2L10      ----------------c--------tacctgca-----------------
A0A250YBR2_BCL2L2-      -------agaagggtta--------tgtctgtg-----------------
A0A250YBR2_BCL2L2-      -------agaagggtta--------tgtctgtg-----------------
A0A8C0WJK2_MCL1-01      tccgcgagggcggcttc--------tggccgcg-----------------
                                                      *                   

A0A250YD48_BCL2L1-      aagagaataggactgaggccccagaagggattgaatcagaggtggagacc
A0A250YD83_BCL2-01      ----acgtgggcgccgcgcccccggaggc--caccccagcgccgggcatc
A0A8C0WAG3_BCL2A1-      ------gcggcacctg---ctgcgggaag--atgagcgagggcgagt---
A0A8C0XBQ2_BCL2L10      ----gtactgcgcccg--------------------------ggagc---
A0A250YBR2_BCL2L2-      ----gagctggccctg-------gagagg----------------gc---
A0A250YBR2_BCL2L2-      ----gagctggccctg-------gagagg----------------gc---
A0A8C0WJK2_MCL1-01      ----gaggaggcctcggcccggcgagagg--tagggggaggggaagc---
                                 *                                        

A0A250YD48_BCL2L1-      cccagtgccatcaatggcaacccatcctggcacctggtggacagccccgc
A0A250YD83_BCL2-01      ttctccttccagcccgggagcaaccccctgcccgctgcgccccgggaccg
A0A8C0WAG3_BCL2A1-      --tcgccttcacg-------catgcgctggcccaggactacctgcgccac
A0A8C0XBQ2_BCL2L10      --ccgagc------------cgggcgcccccgagccgcccccgtccacgc
A0A250YBR2_BCL2L2-      --c-----------------cagctgctgacccgttacaccaagccatgc
A0A250YBR2_BCL2L2-      --c-----------------cagctgctgacccgttacaccaagccatgc
A0A8C0WJK2_MCL1-01      --cggtgcggtgattggcggcagc-gcaggcgcgagccccccggccgccc
                                            *     *   *                   

A0A250YD48_BCL2L1-      agtgaatgga----------------------gccactggccacagcagc
A0A250YD83_BCL2-01      ggccgccaggac-----------------cacgtcgctgcc---------
A0A8C0WAG3_BCL2A1-      gtgctgcaggtg-----------------cagcccgccggcctgggggcc
A0A8C0XBQ2_BCL2L10      ccgaggccgccgtgctg------------cgcgccgccgcc---------
A0A250YBR2_BCL2L2-      gggcagctgga-----gatgagtttgagacccgcttccggc---------
A0A250YBR2_BCL2L2-      gggcagctgga-----gatgagtttgagacccgcttccggc---------
A0A8C0WJK2_MCL1-01      tggc-gcaggacgcccgaagggt------cgcgcggccggc---------
                                *                           * * *         

A0A250YD48_BCL2L1-      agtttggatgccc-----gggaggtgatccccatgacagcagtg------
A0A250YD83_BCL2-01      ---------gcccccggtcgcccccgccgcccgcgccgggcctgcgctca
A0A8C0WAG3_BCL2A1-      agcaaggcggccc---gagtgctgcgaga----cgtcgccttct------
A0A8C0XBQ2_BCL2L10      ---------accc---ggttacggcg---tcgccactgggcctt------
A0A250YBR2_BCL2L2-      ---------gcac---att--ctctga----tctggcggctcag------
A0A250YBR2_BCL2L2-      ---------gcac---att--ctctga----tctggcggctcag------
A0A8C0WJK2_MCL1-01      ---------gccc---attggcgccgagatccccgacgtcactg------
                                  * *            *                        

A0A250YD48_BCL2L1-      --------------------aagcaagcgctgagggaggcaggtgacgag
A0A250YD83_BCL2-01      gcccagtaccacctgtggtccacctgaccctccgccaggctggcgatgac
A0A8C0WAG3_BCL2A1-      -------------------------------------------------c
A0A8C0XBQ2_BCL2L10      -------------------------------------------------c
A0A250YBR2_BCL2L2-      -------------------------------------------------c
A0A250YBR2_BCL2L2-      -------------------------------------------------c
A0A8C0WJK2_MCL1-01      -------------------------------------------------c
                                                                          

A0A250YD48_BCL2L1-      tttgaactgcggtaccggcgggcattcagtgacctgacatcccagctcca
A0A250YD83_BCL2-01      ttctcccggcgctaccgccgcgacttcgccgagatgtccagccagctgca
A0A8C0WAG3_BCL2A1-      catccaagaagaagtggaaaagagtctgcagccatacttggacaaatgtg
A0A8C0XBQ2_BCL2L10      ttctcccg------------ctacatcgg----ctaccagggcaatcgcg
A0A250YBR2_BCL2L2-      ta--catg------------tga----------ccccaggctcagcc---
A0A250YBR2_BCL2L2-      ta--catg------------tga----------ccccaggctcagcc---
A0A8C0WJK2_MCL1-01      gacccctg------------cgaggctgctgttcttcgcgcccacccgcc
                                                                  **      

A0A250YD48_BCL2L1-      ca----taaccccggggacagcatatcagagctttgaacaggtagtg--a
A0A250YD83_BCL2-01      cc----tgacgcccttcaccgcgaggggacgctttgccacggtggtg--g
A0A8C0WAG3_BCL2A1-      atgtggcgtccgtagatactgccagaaccatattcaatcaagtgatg--g
A0A8C0XBQ2_BCL2L10      tcgagctgatggcgcggatggccgaagctacgttc--tc---cgaca---
A0A250YBR2_BCL2L2-      ---cagcaacgcttca-----------cccaggtc--tc---tgatg---
A0A250YBR2_BCL2L2-      ---cagcaacgcttca-----------cccaggtc--tc---tgatg---
A0A8C0WJK2_MCL1-01      gtgcgtcgacgcctaaggagatggaagccccggcc--tc---cgacgcca
                                                                          

A0A250YD48_BCL2L1-      acgaactcttccgggatggggt----------aaactggggtcgcattg-
A0A250YD83_BCL2-01      aggagctcttcagggatggggt----------gaactgggggaggattg-
A0A8C0WAG3_BCL2A1-      aaaaggaattcgaagacggcgt-------cattaactgggggaggattg-
A0A8C0XBQ2_BCL2L10      --------accgcgg--------------cctcaactggggccgcgtag-
A0A250YBR2_BCL2L2-      --aacttttccaaggggg-----------ccccaactggggccgtcttg-
A0A250YBR2_BCL2L2-      --aacttttccaaggggg-----------ccccaactggggccgtcttg-
A0A8C0WJK2_MCL1-01      tcatgtcgcccgaagaggagctggacggctacgagccggagcc-tctcgg
                                  *   *                  * * ** *     * * 

A0A250YD48_BCL2L1-      --------tggcctttttctccttcggcggggcactgtgcgtg------g
A0A250YD83_BCL2-01      --------tggccttctttgagttcggtggggtcatgtgtgtg------g
A0A8C0WAG3_BCL2A1-      --------tgaccatatttgcattcggaggagttctcatcaag-------
A0A8C0XBQ2_BCL2L10      --------tgacgctcgcggccttcgcggggacgctgctggag-------
A0A250YBR2_BCL2L2-      --------tggccttctttgtctt--tggggctgccctgtgtg----ctg
A0A250YBR2_BCL2L2-      --------tggccttctttgtctt--tggggctgccctgtgtg----ctg
A0A8C0WJK2_MCL1-01      gaagcggccggctgtcctacccttgctggagttggtcggggaggccacta
                                 * *  *       **    *             *       

A0A250YD48_BCL2L1-      aaagcgtagacaaggagatgca----------------------------
A0A250YD83_BCL2-01      agagcgtcaaccgggagatgtc----------------------------
A0A8C0WAG3_BCL2A1-      -aaacttctacgagagcggatt----------------------------
A0A8C0XBQ2_BCL2L10      --------------------------------------------------
A0A250YBR2_BCL2L2-      agagcatcaac---------------------------------------
A0A250YBR2_BCL2L2-      agagcatcaac---------------------------------------
A0A8C0WJK2_MCL1-01      agagccccagcgcggacgggtcactgccctcaacgccacccccagcagag
                                                                          

A0A250YD48_BCL2L1-      --------------------------------------------------
A0A250YD83_BCL2-01      --------------------------------------------------
A0A8C0WAG3_BCL2A1-      --------------------------------------------------
A0A8C0XBQ2_BCL2L10      --agagg-------------------------------------------
A0A250YBR2_BCL2L2-      aaagagatgga---------------------------------------
A0A250YBR2_BCL2L2-      aaagagatgga---------------------------------------
A0A8C0WJK2_MCL1-01      gaggaggaggacgaattgtaccggcagtcgctagagattatctgccggta
                                                                          

A0A250YD48_BCL2L1-      -------------ggtattggtg-------agtcggatcgcaagttggat
A0A250YD83_BCL2-01      -------------gcctctggtg-------gacaacatcgccttgtggat
A0A8C0WAG3_BCL2A1-      -------------gccccagatg----------------------tggat
A0A8C0XBQ2_BCL2L10      -------------gccgtcggtg-------------gtcgccgagtggaa
A0A250YBR2_BCL2L2-      -------------accactggtg----gga---caagtacaggagtggat
A0A250YBR2_BCL2L2-      -------------accactggtg----gga---caagtacaggagtggat
A0A8C0WJK2_MCL1-01      ccttcgcgagcaggccaccggcgccaaggacgccaagccaatgggcgggt
                                           *  *                       **  

A0A250YD48_BCL2L1-      ----ggctacttac---------ctgaa------tgaccacctagaacct
A0A250YD83_BCL2-01      ----gattgagtac---------ctgaa------ccggcacctgcacacc
A0A8C0WAG3_BCL2A1-      --------acttac---------atggagatttctt----actttgtggc
A0A8C0XBQ2_BCL2L10      ----gacgcgccac--gaagttgcccgggac---------tgtccgcgcc
A0A250YBR2_BCL2L2-      ----ggtggcctac---------ctggagac------acgcctagccgac
A0A250YBR2_BCL2L2-      ----ggtggcctac---------ctggagac------acgcctagccgac
A0A8C0WJK2_MCL1-01      ctggggcggccagcaggaaggcgctggagaccctgcgacgggtcggcgac
                                     *                            *       

A0A250YD48_BCL2L1-      tggatccaggagaa----------------------------cggcggct
A0A250YD83_BCL2-01      tggatccaggataa----------------------------cggaggct
A0A8C0WAG3_BCL2A1-      tgagttcatagt--------------------------------------
A0A8C0XBQ2_BCL2L10      tggtggccttgc------------------------------tgtgcgct
A0A250YBR2_BCL2L2-      tggatccacagcag----------------------------tgggggct
A0A250YBR2_BCL2L2-      tggatccacagcag----------------------------tgggggct
A0A8C0WJK2_MCL1-01      ggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaact
                         *    *                                           

A0A250YD48_BCL2L1-      ggg----------------------acacttttgt-------------gg
A0A250YD83_BCL2-01      ggg----------------------atgcctttgt---------------
A0A8C0WAG3_BCL2A1-      --------------------------------------------------
A0A8C0XBQ2_BCL2L10      cggc---------------------------tcgt---------------
A0A250YBR2_BCL2L2-      gggcg--------------gagttcacagctctgta--------------
A0A250YBR2_BCL2L2-      gggcg--------------gagttcacagctctgta--------------
A0A8C0WJK2_MCL1-01      ggacatcaaaaatgaggacgatgtcaaatctttgtctcgagtgatgatcc
                                                                          

A0A250YD48_BCL2L1-      aactctatggaaacaatgcagcagccgagagccgg---------------
A0A250YD83_BCL2-01      ---------ggaactgtatggc--cccagtgtgcgacctctgtttgactt
A0A8C0WAG3_BCL2A1-      ----------gaataacacaggagaatggataaag---------------
A0A8C0XBQ2_BCL2L10      ---------gggacagcaccgtgcctggctggagg---------------
A0A250YBR2_BCL2L2-      -------cggggacggggc-----cctggaggagg---------------
A0A250YBR2_BCL2L2-      -------cggggacggggc-----cctggaggagg---------------
A0A8C0WJK2_MCL1-01      atgttttcagtgacggcgtaacaaactggggcaggattgtgactctaatt
                                    *                     *               

A0A250YD48_BCL2L1-      -----aagggcc-------------------------------aggagcg
A0A250YD83_BCL2-01      ctcctggctgtct-------------------------------------
A0A8C0WAG3_BCL2A1-      caaaacggaggctggg---------------------------aaaatgg
A0A8C0XBQ2_BCL2L10      -ctcaaggcggct------------------------------gggatgg
A0A250YBR2_BCL2L2-      ---cgcggcgcctgcggg-------------------------aggggaa
A0A250YBR2_BCL2L2-      ---cgcggcgcctgcggg-------------------------aggggaa
A0A8C0WJK2_MCL1-01      tcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaag
                                 * *                                      

A0A250YD48_BCL2L1-      ctt-----------------------caaccgctggttcctgacaggcat
A0A250YD83_BCL2-01      ----------------------------------------ctgaagactc
A0A8C0WAG3_BCL2A1-      ctt---------------------tataa-----------agaagtttga
A0A8C0XBQ2_BCL2L10      ctt--------------------ttgtca-------gttcttcaggacac
A0A250YBR2_BCL2L2-      ctg-------------------ggcatca-----------gtgaggaca-
A0A250YBR2_BCL2L2-      ctg-------------------ggcatca-----------gtgaggaca-
A0A8C0WJK2_MCL1-01      ctgcattgaaccattagcagaaagtatcacagacgttctcgtaaggacaa
                                                                          

A0A250YD48_BCL2L1-      gactgtggctggc------------gtggtt-------------------
A0A250YD83_BCL2-01      tgctcagcctggcc---------------ctg------------------
A0A8C0WAG3_BCL2A1-      acctaagtctggct-------------ggctg------------------
A0A8C0XBQ2_BCL2L10      ccttaccactcactttttggagaagacggttg------------------
A0A250YBR2_BCL2L2-      ----g-tgctgac-----------gggggct-------------------
A0A250YBR2_BCL2L2-      ----g-tgctgac-----------gggggct-------------------
A0A8C0WJK2_MCL1-01      aacgg-gactggctagtcaaacaaagaggctgggatgggtttgtggagtt
                                **  *                 *                   

A0A250YD48_BCL2L1-      ----------------------------------------ctg-------
A0A250YD83_BCL2-01      ----------------------------------------gtgggagtct
A0A8C0WAG3_BCL2A1-      ----------------------------------acttttctggaagtca
A0A8C0XBQ2_BCL2L10      ----------------------------atctggactttcctgtcatgct
A0A250YBR2_BCL2L2-      -----------------------gtggca-----------ctgggggccc
A0A250YBR2_BCL2L2-      -----------------------gtggca-----------ctgggggccc
A0A8C0WJK2_MCL1-01      cttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggctt
                                                                 **       

A0A250YD48_BCL2L1-      -----------------ctgggctcgctcttcagtc------ggaaat--
A0A250YD83_BCL2-01      gtatcacc---------ctgggtgcctacctgggcc------acaagt--
A0A8C0WAG3_BCL2A1-      tagaaaagatctacgacatgctgtccctcctga---ggctatactatt--
A0A8C0XBQ2_BCL2L10      ttttagcaacggcc---ttaatgtatttctggacacagttacataagttc
A0A250YBR2_BCL2L2-      tggtaact---------gtaggggccttttttg-----cta-gcaagt--
A0A250YBR2_BCL2L2-      tggtaact---------gtaggggccttttttg-----cta-gcaagt--
A0A8C0WJK2_MCL1-01      ttgcaggtgttgctggagtaggagctggtttggcatatcta-ataaga--
                                          *                          *    

A0A250YD48_BCL2L1-      ga-
A0A250YD83_BCL2-01      ga-
A0A8C0WAG3_BCL2A1-      ga-
A0A8C0XBQ2_BCL2L10      taa
A0A250YBR2_BCL2L2-      ga-
A0A250YBR2_BCL2L2-      ga-
A0A8C0WJK2_MCL1-01      tag
                         * 

© 1998-2023Legal notice