Dataset for CDS BCL2L2 of organism Saimiri boliviensis boliviensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6TM77_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctggtggcagactt
A0A2K6TM77_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctggtggcagactt
                        **************************************************

A0A2K6TM77_BCL2L2-      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
A0A2K6TM77_BCL2L2-      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
                        **************************************************

A0A2K6TM77_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagcaatgcgggcagctgga
A0A2K6TM77_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagcaatgcgggcagctgga
                        **************************************************

A0A2K6TM77_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
A0A2K6TM77_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
                        **************************************************

A0A2K6TM77_BCL2L2-      gctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccg
A0A2K6TM77_BCL2L2-      gctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccg
                        **************************************************

A0A2K6TM77_BCL2L2-      atgaacttttccaagggggtcccaactggggccgccttgtagccttcttt
A0A2K6TM77_BCL2L2-      atgaacttttccaagggggtcccaactggggccgccttgtagccttcttt
                        **************************************************

A0A2K6TM77_BCL2L2-      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
A0A2K6TM77_BCL2L2-      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
                        **************************************************

A0A2K6TM77_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
A0A2K6TM77_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
                        **************************************************

A0A2K6TM77_BCL2L2-      tggccgactggatccacagcagtgggggctgggcg------gagttcaca
A0A2K6TM77_BCL2L2-      tggccgactggatccacagcagtgggggctgggagctggaagctatcaaa
                        ********************************* *      *   *** *

A0A2K6TM77_BCL2L2-      gctctatacgggg-------------------------------------
A0A2K6TM77_BCL2L2-      gctcgagtcagggagatggaggaagaagctgagaagctaaaggaactaca
                        **** *  * ***                                     

A0A2K6TM77_BCL2L2-      --acgggg------------------------------------------
A0A2K6TM77_BCL2L2-      gaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctg
                          *** **                                          

A0A2K6TM77_BCL2L2-      ---------------ccctggaggaggcg-cggcgtctg-----------
A0A2K6TM77_BCL2L2-      gaccagtgatcatgtccattgaggagaagatggaggctgatgcccgttcc
                                       ** * ******  *  ** * ***           

A0A2K6TM77_BCL2L2-      -------------------------------cgggaggggaactgg----
A0A2K6TM77_BCL2L2-      atctatgttggcaatgtggactatggtgcaacagcagaagagctggaagc
                                                       * * **  ** ****    

A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      tcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgaca
                                                                          

A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      aatttagtggccatcccaaagggtttgcatatatagagttctcagacaaa
                                                                          

A0A2K6TM77_BCL2L2-      gcatcagtgaggacagtgctgac-------------------aggggccg
A0A2K6TM77_BCL2L2-      gagtcagtgaggacttccttggccttagacgagtccctatttagaggacg
                        *  ***********     ** *                   ** ** **

A0A2K6TM77_BCL2L2-      -----------------------------------------tggcactgg
A0A2K6TM77_BCL2L2-      gcaaatcaaggttgactttaaggctttcatttattcatctctgactcagg
                                                                 ** * * **

A0A2K6TM77_BCL2L2-      gggccct-------------------ggtaactgta---------ggggc
A0A2K6TM77_BCL2L2-      tgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggt
                         *  **                    ** * * * *         **** 

A0A2K6TM77_BCL2L2-      ctt-----------------------------------------------
A0A2K6TM77_BCL2L2-      tttccacgagcccgctaccgcgcacggaccaccaactacaacagttcccg
                         **                                               

A0A2K6TM77_BCL2L2-      ------------------ttttgctagcaag-------------------
A0A2K6TM77_BCL2L2-      ctctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca
                                          ****   **** *                   

A0A2K6TM77_BCL2L2-      --------------------------------------tga
A0A2K6TM77_BCL2L2-      ggggccgggctagagcgacatcatggtattccccttactaa
                                                              * *

© 1998-2020Legal notice