Dataset for CDS Unclassified of organism Gouania willdenowi

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C5GAN3_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gouania willdenowi (length=558 residues).
atggagaccactgagaattccaggtgccacagtggggtagcaatatcaaacaatgagatagattggatgggctttggaaa
tagacatgttaatagtttttattctgcaaatgtaagagtgtattttaaccttcactttgttcttacaggcatggtcaaca
tattatcacaaatgaactgctgtgagaatatgacatttgtcagcattgtggggagggatgtttttgcagaccgcactaat
tggggtcgtattgccagccttgtggcctttggggctgttttgtgtcaacacatgaaagaacgaggcaggacaaactgcgt
ggagctggcgtgccagacgatttccacataccttcttacggagcagcgagaatggctaatgaacaacaattcctgggatg
gctctgtagactttttccgagttgcagacccagagtcaacggtcagaaacatactccaggcttttgcaggattcgccggc
attgtggctacactggcctttctgatcaagttaatttggacactcaagaaacttacttttggacttttgttctgttga
>gnl|bcl2dbcds|A0A8C5NH03_uncBCL2L10-01 Putative BCL2-like 10 gene OS=[Eukaryota] Gouania willdenowi (length=573 residues).
atgtcgtgtgggctgcggtcagagaccctcaccctggcagaggactacctgtccctgtgctcaagcccacattcagcacc
tccacctcccagcgaatcagctgctgccatgaggcggatggctggagacctggagtcccagcatcaggcccgcttccatt
ccctggtgcagaccttcctgaggcagtgtgggccggacctctgcaccagcctcaggaaggtgatggaggagatggtgggt
gacggacacttgaactgggggagggttgtatcccttttcacctttagcggggtgctggccagacagctgcaggaggagag
ggctgagaccctggggctggaccctggtctgtggcaggaagcaggacaggggcccaaagaactagcagaaaccattgctg
agtacctgggagtggagaagaaggactggctgctggagaacaaaggatgggaaggtttctgtgcgtactcccgtagaacc
acagaggtgaaccacgacctctccatgaagacggctctgtttgctgctgccggtgtgggcatcgctggcctcaccttcct
cctggtgcgctag
© 1998-2022Legal notice