Dataset for CDS BCL-2-like of organism Paramormyrops kingsleyae

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B3QRZ2_BCL2L1-      atg-----------------------------tcttacagcaacagagaa
A0A3B3TFR4_BCL2L1-      atg-----------------------------tcctacagcaatagggag
A0A3B3SG34_MCL1-01      atgaatccacaaagcttgaagagttacgcgccgattatggtgagcatgaa
A0A3B3R4U0_MCL1-01      atgaatctgatcaat---------------cgtaccacggccacc--ggc
A0A3B3TCS4_BCL2-01      ------------------------------------atggcaaac--gac
                                                            *  *  *    *  

A0A3B3QRZ2_BCL2L1-      ctggtgatggacttcataacgtataaactgtcccagaggaa-----cta-
A0A3B3TFR4_BCL2L1-      ctggtagagtactttgtcagctataagctggcccagaagaa-----ttac
A0A3B3SG34_MCL1-01      ctaccacagacccctgcacc----atggcgtcctggggaaaagcattt--
A0A3B3R4U0_MCL1-01      ttgttct--gccccggcattaaaaatggcgtgaagcagaacggcttctac
A0A3B3TCS4_BCL2-01      gtcccat--a---cgacagccgaaatattgtagag---------------
                         *                      *    *                    

A0A3B3QRZ2_BCL2L1-      --caatgg-------------------ccact---ttgggcttcctgaag
A0A3B3TFR4_BCL2L1-      tccattgc-------------------ccaca---tcatacaggacgaag
A0A3B3SG34_MCL1-01      tgcagtgtctcgattcgtctgcaagagccgcaaacacaccctgtctggag
A0A3B3R4U0_MCL1-01      agctttgtatcggcgtctctgc-----ccgta-----gccccgctcaaag
A0A3B3TCS4_BCL2-01      atctatatat-----------a-----ccata-----a-actgctgaaaa
                          *  *                     **           *       * 

A0A3B3QRZ2_BCL2L1-      ----acag-------------gggtcggacagagggctcgggtcaggccg
A0A3B3TFR4_BCL2L1-      ----ccga-------------cgagcagacaggggg---aggtgagggcg
A0A3B3SG34_MCL1-01      tcctccgggttatgggacgacgagctggacaa-ctgtacggacgaggtgg
A0A3B3R4U0_MCL1-01      -----cgaaaagcgaagag--gagctggacagtctggatgaa-------g
A0A3B3TCS4_BCL2-01      -----caggctatgtgtgg--gaatt--ccaggc-ggccgga-------g
                             *                       **    *             *

A0A3B3QRZ2_BCL2L1-      atgg--------------------------------------gcgcgagg
A0A3B3TFR4_BCL2L1-      aagc--------------------------------------a---gcag
A0A3B3SG34_MCL1-01      acgtgtgtccctgctcgacaagactcgccaaaagggattctgaaaaagag
A0A3B3R4U0_MCL1-01      gcgaacgtttt-------catggagcgccgaaa---------acagagag
A0A3B3TCS4_BCL2-01      acaccgattct-------c--------ccaata---------atggatcg

A0A3B3QRZ2_BCL2L1-      gggttatggtaacagcaactcatg-----------tcaatgggtcggtc-
A0A3B3TFR4_BCL2L1-      gcgctgtgg---------ctcatg-----------ccaatggatcggtc-
A0A3B3SG34_MCL1-01      ccgtgtcggggaa-------gccggttgcccgggagcacaaacgcggtc-
A0A3B3R4U0_MCL1-01      gcgtgattgcgaacaccacttacgggcgtcgggcaacga-agacgggtct
A0A3B3TCS4_BCL2-01      --------gtggactcccctcccggctctcaagttttggcacgccggtc-
                                *              *                     **** 

A0A3B3QRZ2_BCL2L1-      --------attgctggcggcaccagcagc---------------------
A0A3B3TFR4_BCL2L1-      --------agtagcgggaactctgtgggc---------------------
A0A3B3SG34_MCL1-01      ------ggctcactgccgacttccccggacggcgacttgccagcttacgg
A0A3B3R4U0_MCL1-01      ttgccgtccacgccggggacgccgccggactgcgg-------------ga
A0A3B3TCS4_BCL2-01      -------ccaagcagctgccgccggcgga----ga-------------gg
                                      *    *       *                      

A0A3B3QRZ2_BCL2L1-      ------------------------------caggtgtccccagtgcctga
A0A3B3TFR4_BCL2L1-      ------------------------------cagggtgctcc----cctgg
A0A3B3SG34_MCL1-01      acccatttgtggtttctctcgcagcgccgtcgaaatgctgg----accaa
A0A3B3R4U0_MCL1-01      aaatgctgacgtt-----tcccaa------cagggggctca----gccag
A0A3B3TCS4_BCL2-01      acgcgtcgcctgt-----ccgcag------ccggacgccca----gattt
                                                      *      *            

A0A3B3QRZ2_BCL2L1-      gcagccgctccattccccatcgccctctc---------cacaaggcctg-
A0A3B3TFR4_BCL2L1-      aaggc-----------------gccaccc---------cccagggcctg-
A0A3B3SG34_MCL1-01      gagactagcgaattaatcacgactttcttcgccgaatacacggggctgtg
A0A3B3R4U0_MCL1-01      gagactcatgagcttatcgggaccttctt--acggacttacagcggcct-
A0A3B3TCS4_BCL2-01      gatccacacg------------------c--ccggctgcacagggtcct-
                            *                                   *   *     

A0A3B3QRZ2_BCL2L1-      ----------------------gaggcggt----------gaaggaggca
A0A3B3TFR4_BCL2L1-      ----------------------gaggcggt----------gaaggaggcg
A0A3B3SG34_MCL1-01      tgcgacattacagagacgaaacgaggcgctctccacactgaagcgggtgg
A0A3B3R4U0_MCL1-01      cccggcctcggccagccgacacaaagcgtaccctgtcctcagacgagtgg
A0A3B3TCS4_BCL2-01      ------------------gcgcgaagcggg----------ggacgagatc
                                               * ***                * *   

A0A3B3QRZ2_BCL2L1-      ttgcgggattctgccaacgagtttgagctacgctacagccgcgccttcag
A0A3B3TFR4_BCL2L1-      ctgcgactctcagccaacgaatttgagttccggtaccagcgtgccttcag
A0A3B3SG34_MCL1-01      tggcgactgtt-gtcgaaaaacacaagtttgcttacaatggtatgattgg
A0A3B3R4U0_MCL1-01      cggagactgtc-ataggaaagcacttgatcgcgtacaatggcatgattaa
A0A3B3TCS4_BCL2-01      gagaggatgtt-ccag-------cgggacttctcagaaatgcacga----
                          * *    *                *       *     *         

A0A3B3QRZ2_BCL2L1-      cgacctctcctcccagcttcacatcacacccgtc------acggcctacc
A0A3B3TFR4_BCL2L1-      cgacctgtcgtcacagctgcatatcacgccggcc------acagcctacc
A0A3B3SG34_MCL1-01      aaaact------aagtttgaatc--------agcagagtgatgacatga-
A0A3B3R4U0_MCL1-01      aaaact------agaactggata--------agcgtggggacgacacaa-
A0A3B3TCS4_BCL2-01      ------------agagctgcacatcacgcccagc------acggcgcagc
                                         *  *            *      *   *     

A0A3B3QRZ2_BCL2L1-      agagctttgagagtgtaatgaacgaggtgttccgcgatggaatc---aac
A0A3B3TFR4_BCL2L1-      agagcttcgagagcgtcatgaacgaggtgttccgggacggtgtc---aac
A0A3B3SG34_MCL1-01      ccgtaatcaaaactgtagctgagagaatattcagtgatggaaccacaaac
A0A3B3R4U0_MCL1-01      gtttcgtcacgaaggtggccgaggaaatcttcagtgacaaggtcaccaac
A0A3B3TCS4_BCL2-01      gccgcttcacggccgtcatcgaggagctgttcagcgat---ggcgtgaac
                              *       **     *     * *** * **      *   ***

A0A3B3QRZ2_BCL2L1-      tggggccgcatcgtgggcctctttgcctttggcggggccctgtgcgtgga
A0A3B3TFR4_BCL2L1-      tggggccgagtggtgggcctcttcgcctttggtggcgcgttgtgcgtgga
A0A3B3SG34_MCL1-01      tgggggcgtattgccagccttgtggcctttggggcagaggtgtgtaaa--
A0A3B3R4U0_MCL1-01      tggggtcgcatcgccagcctgatagcgtttgggggtgtcgtgtgcaag--
A0A3B3TCS4_BCL2-01      tggggccgtattgtggcgtttctcgagttcggcggcaccatgtgcgtgga
                        ***** **  * *      *  * *  ** ** *      ****      

A0A3B3QRZ2_BCL2L1-      gtgtgtgga--gaagga-----gatgggccacctg-gtggatcgtattgc
A0A3B3TFR4_BCL2L1-      gtgtgtcga--gaagga-----gatgagcccgctg-gtgggccacattgt
A0A3B3SG34_MCL1-01      ------tacctgaaggagactgggcgggagcactgcgtggaggctgtggg
A0A3B3R4U0_MCL1-01      ------tacctgaaagatcacggacagaccaactgcgtggatgatgtggc
A0A3B3TCS4_BCL2-01      gagtgtcaaccgagagat----gacgtcccag----gtggataacattgc
                                   **  **     *             ****      * * 

A0A3B3QRZ2_BCL2L1-      tgactggatgaccgtttacctggacagcaacatccagccctggatccagc
A0A3B3TFR4_BCL2L1-      ggactggatgaccgtctacttggacaaccatatccagccctggattcaaa
A0A3B3SG34_MCL1-01      gaagcagatctcctcctacctgctctcagagcagcgacaatggctactca
A0A3B3R4U0_MCL1-01      aagccggatcagctgctacctgctggaacaccagagggactggctaaacc
A0A3B3TCS4_BCL2-01      acactggatgacggagtacctgaacggaccactgcataactggatccagg
                              ***       *** **                  *** *     

A0A3B3QRZ2_BCL2L1-      ggcagggaggatgggaccgttttgctgaaatctttgggaaggatgcagca
A0A3B3TFR4_BCL2L1-      cccaaggaggatgggatcgcttcgccgagatcttcggcaacgacgcagcc
A0A3B3SG34_MCL1-01      agaacaaggcctggga----------tggatttgtgga------------
A0A3B3R4U0_MCL1-01      gtaacaatggctggga----------gggatttacaga------------
A0A3B3TCS4_BCL2-01      aaaatggtggctgggacgcgtttgtggagatttacgggcaacagcggggt
                           *    *  *****             ** *   *             

A0A3B3QRZ2_BCL2L1-      gctgagagcaggaggtcccaag-agaacttcaaaaagtggctgttagctg
A0A3B3TFR4_BCL2L1-      gccgaaggccgccgctctcggg-agaggttccagcagtggctgccggcgg
A0A3B3SG34_MCL1-01      -----------gttctttcatgtagaagacactgaat-cgttggtcctcc
A0A3B3R4U0_MCL1-01      -----------cttcttctatatggaagacccagagtccactgt---gcg
A0A3B3TCS4_BCL2-01      tcggtgatggcctgcttc----tggccgtacctgaagacagtgtttggcc
                                       *        *                **       

A0A3B3QRZ2_BCL2L1-      ggatgacgctcat------cactggagttgttgtgg--------------
A0A3B3TFR4_BCL2L1-      cgatggcgctggt------cgcgggagcgctggtcg--------------
A0A3B3SG34_MCL1-01      agaaggttcttgt-acatgtttctgagtgcggatcctttgaattacatga
A0A3B3R4U0_MCL1-01      taa-tgctcttgtggcatttgcaggagttgcaagcctgggggctgga---
A0A3B3TCS4_BCL2-01      tggctgctctgggggc---cgtcggggtcacaatca--------gcg---
                                **              * *                       

A0A3B3QRZ2_BCL2L1-      -gctctctcattgcacagaagcgcctgtga
A0A3B3TFR4_BCL2L1-      -gcttcctcatcgccaagaaacgccagtga
A0A3B3SG34_MCL1-01      ccttaaagccttgtgcat--------gtaa
A0A3B3R4U0_MCL1-01      -cttgctctgttgatgag--------gtga
A0A3B3TCS4_BCL2-01      -cctatttcaccaa-gaa--------gtga
                           *            *         ** *

© 1998-2021Legal notice