Dataset for CDS Unclassified of organism Spermophilus dauricus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C9PXQ3_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Spermophilus dauricus (length=438 residues).
atacctcagaggaacctggaactagtgacagactttctgtcctacaagctttcccagaaaggagacagctggagccagct
tggccgtgaggaagagaaccgcgttcaagacccagaaagggctgaatcagaagcgggggcccagcaaagccacccacggc
cacccatcccggcatcagggggacagtcccatggccctaacaggagtttggatgccccagacgtggtccccccggtagcc
gtgaagccagcgccgagggaggcaggcgacaactttgaagggcggtaccggcaggcactccctgacctgacagcagagct
ccgcctcgccccagagacagcacatcacacttttgaacaggtaatggacgaactcttcccggatgagggcaaaccacagc
cacctcttcaaagcagattgaataatcaccctacttaa
© 1998-2023Legal notice