Dataset for CDS BCL2L1 of organism Ictidomys tridecemlineatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A287CZ07_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
I3MUP5_BCL2L1-01        atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
I3MUP5_BCL2L1-02        atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
I3MUP5_BCL2L1-03        atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct

A0A287CZ07_BCL2L1-      ttcccagaaaggatacagctggagtcagtttagcgatgtggaagagaaca
I3MUP5_BCL2L1-01        ttcccagaaaggatacagctggagtcagtttagcgatgtggaagagaaca
I3MUP5_BCL2L1-02        ttcccagaaaggatacagctggagtcagtttagcgatgtggaagagaaca
I3MUP5_BCL2L1-03        ttcccagaaaggatacagctggagtcagtttagcgatgtggaagagaaca

A0A287CZ07_BCL2L1-      ggactgaagccccagaagggactgaatcagaggtggagacccccagtgcc
I3MUP5_BCL2L1-01        ggactgaagccccagaagggactgaatcagaggtggagacccccagtgcc
I3MUP5_BCL2L1-02        ggactgaagccccagaagggactgaatcagaggtggagacccccagtgcc
I3MUP5_BCL2L1-03        ggactgaagccccagaagggactgaatcagaggtggagacccccagtgcc

A0A287CZ07_BCL2L1-      atcaatggcaacccatcctggcatctggccgacagccccgcgataaatgg
I3MUP5_BCL2L1-01        atcaatggcaacccatcctggcatctggccgacagccccgcggtaaatgg
I3MUP5_BCL2L1-02        atcaatggcaacccatcctggcatctggccgacagccccgcggtaaatgg
I3MUP5_BCL2L1-03        atcaatggcaacccatcctggcatctggccgacagccccgcggtaaatgg
                        ****************************************** *******

A0A287CZ07_BCL2L1-      agccactggtcacagcagcagtttggatgcccgggaggtgatccccatgg
I3MUP5_BCL2L1-01        agccactggtcacagcagcagtttggatgcccgggaggtgatccccatgg
I3MUP5_BCL2L1-02        agccactggtcacagcagcagtttggatgcccgggaggtgatccccatgg
I3MUP5_BCL2L1-03        agccactggtcacagcagcagtttggatgcccgggaggtgatccccatgg

A0A287CZ07_BCL2L1-      cagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgtgg
I3MUP5_BCL2L1-01        cagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgcgg
I3MUP5_BCL2L1-02        cagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgcgg
I3MUP5_BCL2L1-03        cagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgcgg
                        *********************************************** **

A0A287CZ07_BCL2L1-      tactggcgggcattcagtgacctgacgtcccagctccacatcaccctggg
I3MUP5_BCL2L1-01        taccggcgggcattcagtgacctgacgtcccagctccacatcaccccggg
I3MUP5_BCL2L1-02        taccggcgggcattcagtgacctgacgtcccagctccacatcaccccggg
I3MUP5_BCL2L1-03        taccggcgggcattcagtgacctgacgtcccagctccacatcaccccggg
                        *** ****************************************** ***

A0A287CZ07_BCL2L1-      gacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
I3MUP5_BCL2L1-01        gacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
I3MUP5_BCL2L1-02        gacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
I3MUP5_BCL2L1-03        gacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg

A0A287CZ07_BCL2L1-      gggtaaactggggtcacattgtggcctttctctcctttggcggggcactg
I3MUP5_BCL2L1-01        gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
I3MUP5_BCL2L1-02        gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
I3MUP5_BCL2L1-03        gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
                        *************** ************* ******* ************

A0A287CZ07_BCL2L1-      tgcatggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
I3MUP5_BCL2L1-01        tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
I3MUP5_BCL2L1-02        tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
I3MUP5_BCL2L1-03        tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
                        *** **********************************************

A0A287CZ07_BCL2L1-      aagttggat---------------------------gccttggatccaag
I3MUP5_BCL2L1-01        aagttggatggccacttacctgaatgaccacctagagccttggatccagg
I3MUP5_BCL2L1-02        aagttggatggccacttacctgaatgaccacctagagccttggatccagg
I3MUP5_BCL2L1-03        aagttggatggccacttacctgaatgaccacctagagccttggatccagg
                        *********                           ************ *

A0A287CZ07_BCL2L1-      agaacggcggctgggacacttttgtggaactctacaggaataatgcggca
I3MUP5_BCL2L1-01        agaacggcggctgggacacttttgtggaactctacgggaataatgcagca
I3MUP5_BCL2L1-02        agaacggcggctgggacacttttgtggaactctacgggaataatgcagca
I3MUP5_BCL2L1-03        agaacggcggctgggacacttttgtggaactctacgggaataatgcagca
                        *********************************** ********** ***

A0A287CZ07_BCL2L1-      gcagagagccggaagggccaggagcgcttcaaccgttggttcctgacggg
I3MUP5_BCL2L1-01        gcagagagccggaagggccaggagcgcttcaaccgttggttcctgacggg
I3MUP5_BCL2L1-02        gcagagagccggaagggccaggagcgcttcaaccgttggttcctgacggg
I3MUP5_BCL2L1-03        gcagagagccggaagggccaggagcgcttcaaccgttggttcctgacggg

A0A287CZ07_BCL2L1-      catgactgtggccggtgtggttctgctgggctcacttttcagtcggaaat
I3MUP5_BCL2L1-01        catgactgtggccggcgtggttctgctgggctcgcttttcagtcggaaat
I3MUP5_BCL2L1-02        catgactgtggccggcgtggttctgctgggctcgcttttcagtcggaaat
I3MUP5_BCL2L1-03        catgactgtggccggcgtggttctgctgggctcgcttttcagtcggaaat
                        *************** ***************** ****************

A0A287CZ07_BCL2L1-      ga
I3MUP5_BCL2L1-01        ga
I3MUP5_BCL2L1-02        ga
I3MUP5_BCL2L1-03        ga

© 1998-2022Legal notice