Dataset for CDS BCL2L1 of organism Dicentrarchus labrax

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4IRU9_BCL2L1-      atgtcgtacagtaacagagagctggtggagttctttataagctataaact
E6ZFR0_BCL2L1-01        atgtcgtacagtaacagagagctggtggagttctttataagctataaact
                        **************************************************

A0A8C4IRU9_BCL2L1-      gtctcagaggaaccacccaacctctctactgaggccggagaatgccggtg
E6ZFR0_BCL2L1-01        gtctcagaggaaccacccaacctctctactgaggccggagaatgccggtg
                        **************************************************

A0A8C4IRU9_BCL2L1-      aaaggactgagggagacaaggccaactcagctgccagaaacggcttgctg
E6ZFR0_BCL2L1-01        aaaggactgagggagacaaggccaactcagctgccagaaacggcttgctg
                        **************************************************

A0A8C4IRU9_BCL2L1-      gcca------------------------------------------gcgc
E6ZFR0_BCL2L1-01        gccagcaagaacacaagtggccagccggggacgtcttcgtcctcaggcgc
                        ****                                          ****

A0A8C4IRU9_BCL2L1-      tgacatagaggctgtaaaggcagctcttcgggactcggcagatgagtttg
E6ZFR0_BCL2L1-01        tgacatagaggctgtaaaggcagctcttcgggactcggcagatgagtttg
                        **************************************************

A0A8C4IRU9_BCL2L1-      aactgctcttcacgcaagcgtttagtgacctttcctcgcagattgacatc
E6ZFR0_BCL2L1-01        aactgctcttcacgcaagcgtttagtgacctttcctcgcagattgacatc
                        **************************************************

A0A8C4IRU9_BCL2L1-      actcctgacacggcctaccacagctttaaaagcgtgatggacgaggtgtt
E6ZFR0_BCL2L1-01        actcctgacacggcctaccacagctttaaaagcgtgatggacgaggtgtt
                        **************************************************

A0A8C4IRU9_BCL2L1-      caaggatggagtgaactggggacgtatagtgggcctgtttgcctttggcg
E6ZFR0_BCL2L1-01        caaggatggagtgaactggggacgtatagtgggcctgtttgcctttggcg
                        **************************************************

A0A8C4IRU9_BCL2L1-      gtgtactgtgtgtagaatgtgtcgagaaagatatgagtgagctggtttcc
E6ZFR0_BCL2L1-01        gtgtactgtgtgtagaatgtgtcgagaaagatatgagtgagctggtttcc
                        **************************************************

A0A8C4IRU9_BCL2L1-      cgcatcgcagactggatgaccatgtacctggatgagcacatcagtccgtg
E6ZFR0_BCL2L1-01        cgcatcgcagactggatgaccatgtacctggatgagcacatcagtccgtg
                        **************************************************

A0A8C4IRU9_BCL2L1-      gatccagagccaaggaggatgggactgctttgctgaggtttttgggcgag
E6ZFR0_BCL2L1-01        gatccagagccaaggaggatgggactgctttgctgaggtttttgggcgag
                        **************************************************

A0A8C4IRU9_BCL2L1-      acgccgccgcagaagcgaggagatctcgggagactctgagtagatggctg
E6ZFR0_BCL2L1-01        acgccgccgcagaagcgaggagatctcgggagactctgagtagatggctg
                        **************************************************

A0A8C4IRU9_BCL2L1-      ctaattggggtggcgctgctaatgggagctgtggtcggggttctcattgc
E6ZFR0_BCL2L1-01        ctaattggggtggcgctgctaatgggagctgtggtcggggttctcattgc
                        **************************************************

A0A8C4IRU9_BCL2L1-      taagaaacattga
E6ZFR0_BCL2L1-01        taagaaacattga
                        *************

© 1998-2023Legal notice