Dataset for CDS BAK1 of Organism Chelydra serpentina

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3RNW8_BAK1-01      actgggtcaggccagaataagggcaccccgaccgcttttgctgcctgcct
A0A8C3RNW8_BAK1-02      actgggtcaggccagaataagggcaccccgaccgcttttgctgcctgcct
A0A8C3S4Y3_BAK1-01      actgggtcaggccagaataagggcaccccgaccgcttttgctgcctgcct
A0A8C3S4Y3_BAK1-02      actgggtcaggccagaataagggcaccccgaccgcttttgctgcctgcct
                        **************************************************

A0A8C3RNW8_BAK1-01      gaccctgccaatcattgtctctccctcagaagatcaggtggctcaggaga
A0A8C3RNW8_BAK1-02      gaccctgccaatcattgtctctccctcagaagatcaggtggctcaggaga
A0A8C3S4Y3_BAK1-01      gaccctgccaatcattgtctctccctcagaagatcaggtggctcaggaga
A0A8C3S4Y3_BAK1-02      gaccctgccaatcattgtctctccctcagaagatcaggtggctcaggaga
                        **************************************************

A0A8C3RNW8_BAK1-01      ccgaggaggtgttccggagctatgccttctaccgctaccagcaggagagg
A0A8C3RNW8_BAK1-02      ccgaggaggtgttccggagctatgccttctaccgctaccagcaggagagg
A0A8C3S4Y3_BAK1-01      ccgaggaggtgttccggagctatgccttctaccgctaccagcaggagagg
A0A8C3S4Y3_BAK1-02      ccgaggaggtgttccggagctatgccttctaccgctaccagcaggagagg
                        **************************************************

A0A8C3RNW8_BAK1-01      gaagagggcgaaggtgaggtgccaatggaccctgagattgcagagatcca
A0A8C3RNW8_BAK1-02      gaagagggcgaaggtgaggtgccaatggaccctgagattgcagagatcca
A0A8C3S4Y3_BAK1-01      gaagagggcgaaggtgaggtgccaatggaccctgagattgcagagatcca
A0A8C3S4Y3_BAK1-02      gaagagggcgaaggtgaggtgccaatggaccctgagattgcagagatcca
                        **************************************************

A0A8C3RNW8_BAK1-01      gcaggagccgggcagcaccagcaaccaggtgggcaggcgcctggccatca
A0A8C3RNW8_BAK1-02      gcaggagccgggcagcaccagcaaccaggtgggcaggcgcctggccatca
A0A8C3S4Y3_BAK1-01      gcaggagccgggcagcaccagcaaccaggtgggcaggcgcctggccatca
A0A8C3S4Y3_BAK1-02      gcaggagccgggcagcaccagcaaccaggtgggcaggcgcctggccatca
                        **************************************************

A0A8C3RNW8_BAK1-01      tcggagatgacatcaacatgcggtatgacgcagagttccggaacatgctg
A0A8C3RNW8_BAK1-02      tcggagatgacatcaacatgcggtatgacgcagagttccggaacatgctg
A0A8C3S4Y3_BAK1-01      tcggagatgacatcaacatgcggtatgacgcagagttccggaacatgctg
A0A8C3S4Y3_BAK1-02      tcggagatgacatcaacatgcggtatgacgcagagttccggaacatgctg
                        **************************************************

A0A8C3RNW8_BAK1-01      aagaccctgcagcccacgaaggacaatgcctatgagtacttcactaagat
A0A8C3RNW8_BAK1-02      aagaccctgcagcccacgaaggacaatgcctatgagtacttcactaagat
A0A8C3S4Y3_BAK1-01      aagaccctgcagcccacgaaggacaatgcctatgagtacttcactaagat
A0A8C3S4Y3_BAK1-02      aagaccctgcagcccacgaaggacaatgcctatgagtacttcactaagat
                        **************************************************

A0A8C3RNW8_BAK1-01      agcctccagcttgtttgacagcggcattaactggggcagggtgattgcgc
A0A8C3RNW8_BAK1-02      agcctccagcttgtttgacagcggcattaactggggcagggtgattgcgc
A0A8C3S4Y3_BAK1-01      agcctccagcttgtttgacagcggcattaactggggcagggtgattgcgc
A0A8C3S4Y3_BAK1-02      agcctccagcttgtttgacagcggcattaactggggcagggtgattgcgc
                        **************************************************

A0A8C3RNW8_BAK1-01      tgctggggttcggttaccggatggcgatccatgtgtatcagcacggggtg
A0A8C3RNW8_BAK1-02      tgctggggttcggttaccggatggcgatccatgtgtatcagcacggggtg
A0A8C3S4Y3_BAK1-01      tgctggggttcggttaccggatggcgatccatgtgtatcagcacggggtg
A0A8C3S4Y3_BAK1-02      tgctggggttcggttaccggatggcgatccatgtgtatcagcacggggtg
                        **************************************************

A0A8C3RNW8_BAK1-01      accggcttcctccggagcatcgcccgctatgtcgcagaattcgtgctccg
A0A8C3RNW8_BAK1-02      accggcttcctccggagcatcgcccgctatgtcgcagaattcgtgctccg
A0A8C3S4Y3_BAK1-01      accggcttcctccggagcatcgcccgctatgttgcagaattcgtgctccg
A0A8C3S4Y3_BAK1-02      accggcttcctccggagcatcgcccgctatgttgcagaattcgtgctccg
                        ******************************** *****************

A0A8C3RNW8_BAK1-01      caaccgcatcgcccagtggatcgccgaccagggaggatgggtgagtgagc
A0A8C3RNW8_BAK1-02      caaccgcatcgcccagtggatcgccgaccagggaggatgggtgagtgagc
A0A8C3S4Y3_BAK1-01      caaccgcatcgcccagtggatcgccgaccagggaggatgggtgagtgagc
A0A8C3S4Y3_BAK1-02      caaccgcatcgcccagtggatcgccgaccagggaggatgggtgagtgagc
                        **************************************************

A0A8C3RNW8_BAK1-01      ctggctttttttctct----------------------------------
A0A8C3RNW8_BAK1-02      ct------------------------------------------------
A0A8C3S4Y3_BAK1-01      ctggctttttttctctgctgggccgggctagggtcagcacgattcctcgc
A0A8C3S4Y3_BAK1-02      ct------------------------------------------------
                        **                                                

A0A8C3RNW8_BAK1-01      ---gctgggccggttaggccaaaatgt------tcaaacttag
A0A8C3RNW8_BAK1-02      ---gctgggctttgtgagc---agtgttgctggtcaaattga-
A0A8C3S4Y3_BAK1-01      ttagctgggctttgtgagc---agtgttgctggtcagattga-
A0A8C3S4Y3_BAK1-02      ---gctgggctttgtgagc---agtgttgctggtcagattga-
                           *******    *  **   * ***      *** * * * 

© 1998-2023Legal notice