Dataset for CDS MCL-1 of organism Rhinopithecus roxellana

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6PPI3_MCL1-03      atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A2K6PPI3_MCL1-02      atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgg
                        **************************************************

A0A2K6PPI3_MCL1-03      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
A0A2K6PPI3_MCL1-02      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
                        **************************************************

A0A2K6PPI3_MCL1-03      ggcttttggccac--------------cggc---gccaaggacacaaagc
A0A2K6PPI3_MCL1-02      ggcttttggctacggagaaggaggcctcggcccggcgagagataggggga
                        ********** **              ****   ** *  ** *    * 

A0A2K6PPI3_MCL1-03      caatgggcaggtctgg-----ggc-----caccagcaggaaggctctgg-
A0A2K6PPI3_MCL1-02      ggggaggccggcacggtgattggcgaaagcgccggcgcaagccccccggc
                             *** **   **     ***     * ** **   *   * * ** 

A0A2K6PPI3_MCL1-03      agaccttac----gacgggtgggggatggcgtg-----------------
A0A2K6PPI3_MCL1-02      cgccctcacgccagacgcccggagggtcgcgcggccgccgcccattggcg
                         * *** **    ****   ** ** * *** *                 

A0A2K6PPI3_MCL1-03      -------------------cagcgcaaccacgagacggcttt--------
A0A2K6PPI3_MCL1-02      ccgaggtccccgacgtcaccgggacccccgcgaggctgcttttctttgcg
                                           * *  *  ** **** * *****        

A0A2K6PPI3_MCL1-03      -----ccaaggcatg------cttcggaaactggacatcaaaaacgaaga
A0A2K6PPI3_MCL1-02      cccacccgccgcgcggcgcctcttgaggagatggaagccccggccgccga
                             **   **  *      ***  * *  ****   *     **  **

A0A2K6PPI3_MCL1-03      cgatgtca------------------------------------------
A0A2K6PPI3_MCL1-02      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
                        **   ***                                          

A0A2K6PPI3_MCL1-03      ---------------------------------------------aatct
A0A2K6PPI3_MCL1-02      tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatct
                                                                     *****

A0A2K6PPI3_MCL1-03      t----tatctcgagt---gatggtcca-tgttttcagcgacggcg-taac
A0A2K6PPI3_MCL1-02      ggtaatagctccagtacggatgggtcactaccctcgacgccgccgccagc
                             ** *** ***   *****  ** *    **  ** ** **  * *

A0A2K6PPI3_MCL1-03      aaactggggcagga-------ttgt---gactctcatt--------tctt
A0A2K6PPI3_MCL1-02      aga--ggaggaggaggacgagttgtaccggcagtcactggaaattatctc
                        * *  ** * ****       ****   * *  *** *        *** 

A0A2K6PPI3_MCL1-03      ttggtgcctttgtggctaaacacttg-----aagaccataaa-ccaagaa
A0A2K6PPI3_MCL1-02      tcggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgg
                        * *** **** * *   *  *    *     ***  ** *** ****   

A0A2K6PPI3_MCL1-03      agttgcatcgaaccattagcagaaagtatc-acagacgttctcgtaagga
A0A2K6PPI3_MCL1-02      gcaggtctggggccaccagcaggaaggctctggagacctt------acga
                            *  * *  ***  ***** ***  **   **** **      * **

A0A2K6PPI3_MCL1-03      caaaacgggactggc---tagttaaacaaagaggctg--------ggatg
A0A2K6PPI3_MCL1-02      cgggtgggggatggcgtgcagcgcaaccacgagacggctttccaaggatg
                        *     ***  ****    **   *** * *** * *        *****

A0A2K6PPI3_MCL1-03      ggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaat
A0A2K6PPI3_MCL1-02      ggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaat
                        **************************************************

A0A2K6PPI3_MCL1-03      gtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
A0A2K6PPI3_MCL1-02      gtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
                        **************************************************

A0A2K6PPI3_MCL1-03      tctaataagatag-----------
A0A2K6PPI3_MCL1-02      tctaataagatagccttactgtaa
                        *************           

© 1998-2020Legal notice