Dataset for CDS MCL-1 of organism Rhinopithecus roxellana

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6PPI3_MCL1-02      atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A2K6PPI3_MCL1-01      atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A2K6PPI3_MCL1-03      atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgg

A0A2K6PPI3_MCL1-02      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
A0A2K6PPI3_MCL1-01      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
A0A2K6PPI3_MCL1-03      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc

A0A2K6PPI3_MCL1-02      ggcttttggctacggagaaggaggcctcggcccggcgagagataggggga
A0A2K6PPI3_MCL1-01      ggcttttggctacggagaaggaggcctcggcccggcgagagataggggga
A0A2K6PPI3_MCL1-03      ggctttt-------------------------------------------

A0A2K6PPI3_MCL1-02      ggggaggccggcacggtgattggcgaaagcgccggcgcaagccccccggc
A0A2K6PPI3_MCL1-01      ggggaggccggcacggtgattggcgaaagcgccggcgcaagccccccggc
A0A2K6PPI3_MCL1-03      --------------------------------------------------

A0A2K6PPI3_MCL1-02      cgccctcacgccagacgcccggagggtcgcgcggccgccgcccattggcg
A0A2K6PPI3_MCL1-01      cgccctcacgccagacgcccggagggtcgcgcggccgccgcccattggcg
A0A2K6PPI3_MCL1-03      --------------------------------------------------

A0A2K6PPI3_MCL1-02      ccgaggtccccgacgtcaccgggacccccgcgaggctgcttttctttgcg
A0A2K6PPI3_MCL1-01      ccgaggtccccgacgtcaccgggacccccgcgaggctgcttttctttgcg
A0A2K6PPI3_MCL1-03      --------------------------------------------------

A0A2K6PPI3_MCL1-02      cccacccgccgcgcggcgcctcttgaggagatggaagccccggccgccga
A0A2K6PPI3_MCL1-01      cccacccgccgcgcggcgcctcttgaggagatggaagccccggccgccga
A0A2K6PPI3_MCL1-03      --------------------------------------------------

A0A2K6PPI3_MCL1-02      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
A0A2K6PPI3_MCL1-01      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
A0A2K6PPI3_MCL1-03      --------------------------------------------------

A0A2K6PPI3_MCL1-02      tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatct
A0A2K6PPI3_MCL1-01      tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatct
A0A2K6PPI3_MCL1-03      --------------------------------------------------

A0A2K6PPI3_MCL1-02      ggtaatagctccagtacggatgggtcactaccctcgacgccgccgccagc
A0A2K6PPI3_MCL1-01      ggtaatagctccagtacggatgggtcactaccctcgacgccgccgccagc
A0A2K6PPI3_MCL1-03      --------------------------------------------------

A0A2K6PPI3_MCL1-02      agaggaggaggaggacgagttgtaccggcagtcactggaaattatctctc
A0A2K6PPI3_MCL1-01      agaggaggaggaggacgagttgtaccggcagtcactggaaattatctctc
A0A2K6PPI3_MCL1-03      --------------------------------------------------

A0A2K6PPI3_MCL1-02      ggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
A0A2K6PPI3_MCL1-01      ggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
A0A2K6PPI3_MCL1-03      ----------------ggccaccggcgccaaggacacaaagccaatgggc

A0A2K6PPI3_MCL1-02      aggtctggggccaccagcaggaaggctctggagaccttacgacgggtggg
A0A2K6PPI3_MCL1-01      aggtctggggccaccagcaggaaggctctggagaccttacgacgggtggg
A0A2K6PPI3_MCL1-03      aggtctggggccaccagcaggaaggctctggagaccttacgacgggtggg

A0A2K6PPI3_MCL1-02      ggatggcgtgcagcgcaaccacgagacggctttccaa-------------
A0A2K6PPI3_MCL1-01      ggatggcgtgcagcgcaaccacgagacggctttccaaggcatgcttcgga
A0A2K6PPI3_MCL1-03      ggatggcgtgcagcgcaaccacgagacggctttccaaggcatgcttcgga

A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-01      aactggacatcaaaaacgaagacgatgtcaaatctttatctcgagtgatg
A0A2K6PPI3_MCL1-03      aactggacatcaaaaacgaagacgatgtcaaatctttatctcgagtgatg

A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-01      gtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
A0A2K6PPI3_MCL1-03      gtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct

A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-01      catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaag
A0A2K6PPI3_MCL1-03      catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaag

A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-01      aaagttgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2K6PPI3_MCL1-03      aaagttgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg

A0A2K6PPI3_MCL1-02      -----------------------------------ggatgggtttgtgga
A0A2K6PPI3_MCL1-01      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtgga
A0A2K6PPI3_MCL1-03      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtgga

A0A2K6PPI3_MCL1-02      gttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctgg
A0A2K6PPI3_MCL1-01      gttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctgg
A0A2K6PPI3_MCL1-03      gttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctgg

A0A2K6PPI3_MCL1-02      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
A0A2K6PPI3_MCL1-01      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
A0A2K6PPI3_MCL1-03      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga

A0A2K6PPI3_MCL1-02      tagccttactgtaa
A0A2K6PPI3_MCL1-01      tag-----------
A0A2K6PPI3_MCL1-03      tag-----------

© 1998-2023Legal notice