Dataset for CDS BAK1 of Organism Anas platyrhynchos platyrhynchos

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A493TW00_BAK1-01      atggtctggggttgggtttctaatttttttttttttttttcggtctctct
A0A493TW00_BAK1-02      atggtctggggttgggtttctaatttttttttttttttttcggtctctct
                        **************************************************

A0A493TW00_BAK1-01      tcttcttttccctcctcctccccggccctgctcgcttccttcccccgcgc
A0A493TW00_BAK1-02      tcttcttttccctcctcctccccggccctgctcgcttccttcccccgcgc
                        **************************************************

A0A493TW00_BAK1-01      cgcgccgctgcgctccggggaggaggcaggaagggagcggcggggatggg
A0A493TW00_BAK1-02      cgcgccgctgcgctccggggaggaggcaggaagggagcggcggggatggg
                        **************************************************

A0A493TW00_BAK1-01      gcagctccccggagggatgcgttagggctccccgggaccccccccggccc
A0A493TW00_BAK1-02      gcagctccccggagggatgcgttagggctccccgggaccccccccggccc
                        **************************************************

A0A493TW00_BAK1-01      ccctggaccccgccgggagccggtaaagctgatcctccccagcatctctg
A0A493TW00_BAK1-02      ccctggaccccgccgggagccggtaaagctgatcctccccagcatctctg
                        **************************************************

A0A493TW00_BAK1-01      cgatggcctcagggaacgacggagacccaccgagggcccacggacgccgg
A0A493TW00_BAK1-02      cgatggcctcagggaacgacggagacccaccgagggcccacggacgccgg
                        **************************************************

A0A493TW00_BAK1-01      ggcagcaatgggcgcagactgtcacaagagctcaattcagaagaccaggt
A0A493TW00_BAK1-02      ggcagcaatgggcgcagactgtcacaagagctcaattcagaagaccaggt
                        **************************************************

A0A493TW00_BAK1-01      ggctcaggaaaccgaggaggtgtttcggagctacgccttctaccgctacc
A0A493TW00_BAK1-02      ggctcaggaaaccgaggaggtgtttcggagctacgccttctaccgctacc
                        **************************************************

A0A493TW00_BAK1-01      aacaggagagagaagagagcggggaagaagtgcccttggacccggagatt
A0A493TW00_BAK1-02      aacaggagagagaagagagcggggaagaagtgcccttggacccggagatt
                        **************************************************

A0A493TW00_BAK1-01      gcggagatccagcaagacctgggcagtaccgggagcctggtgggaaggcg
A0A493TW00_BAK1-02      gcggagatccagcaagacctgggcagtaccgggagcctggtgggaaggcg
                        **************************************************

A0A493TW00_BAK1-01      cctggccatcatcggcgatgacattaacaagcggtacgacgctgagtttc
A0A493TW00_BAK1-02      cctggccatcatcggcgatgacattaacaagcggtacgacgctgagtttc
                        **************************************************

A0A493TW00_BAK1-01      gctacatgctgaaatccttgcagctcaccaaggagaatgcctacgattac
A0A493TW00_BAK1-02      gctacatgctgaaatccttgcagctcaccaaggagaatgcctacgattac
                        **************************************************

A0A493TW00_BAK1-01      ttcatcaagattgcctccagcctgtttgaaagcggcattaactggggccg
A0A493TW00_BAK1-02      ttcatcaagattgcctccagcctgtttgaaagcggcattaactggggccg
                        **************************************************

A0A493TW00_BAK1-01      ggtgatcgcgctgctgggcttcggctactgcatggccatccacgtctacc
A0A493TW00_BAK1-02      ggtgatcgcgctgctgggcttcggctactgcatggccatccacgtctacc
                        **************************************************

A0A493TW00_BAK1-01      agcacggcataacaggcttcctccgccgcatcgcccgctacgtgacagag
A0A493TW00_BAK1-02      agcacggcataacaggcttcctccgccgcatcgcccgctacgtgacagag
                        **************************************************

A0A493TW00_BAK1-01      ttcatgctgcgcaaccgcatcgcccagtggatcgcccagcagggaggatg
A0A493TW00_BAK1-02      ttcatgctgcgcaaccgcatcgcccagtggatcgcccagcagggaggatg
                        **************************************************

A0A493TW00_BAK1-01      ggtggctgcactcgatctggacaatgtttacatgaagtacatgctggcgg
A0A493TW00_BAK1-02      ggtggctgcactcgatctggacaatgtttacatgaagtacatgctggcgg
                        **************************************************

A0A493TW00_BAK1-01      tggtggccctggtgatggtggggcatttagtggtgactataaggcttgaa
A0A493TW00_BAK1-02      tggtggccctggtgatggtggggcatttagtggta-----------cgac
                        **********************************             ** 

A0A493TW00_BAK1-01      actgtgactggccctgtctga
A0A493TW00_BAK1-02      gcttcttcaggcc----ctga
                         **    * ****    ****

© 1998-2020Legal notice