Dataset for CDS BCL-2-like of organism Ailuropoda melanoleuca

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|G1L3L7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggttgggggccggcagcggcgg
cgccgcctcatcgggagggcggcttttggcttcggggaaggaggccacggcccggagggagatagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgctagtcccccggccactctcgcgccggacgcccggagggtcgcgcggccctcg
cccattggcgccgagggtcccgacgtcacggcgacccccccgaggctactgttcctcgagcccacccgccgcgcgtcgcc
gcctgaagagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggaacctt
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcggtggcccttgtacggacggctcactg
ccctcgacgccacccccagcagaggaggaggaagacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcaacaggcgccaaggacgcgaaaccgctgggcgggtctggggcggccagccggaaggcgttagagaccctcc
gacgggtcggggacggggtacagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaatgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaggctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|G1L3L7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggttgggggccggcagcggcgg
cgccgcctcatcgggagggcggcttttggcaacaggcgccaaggacgcgaaaccgctgggcgggtctggggcggccagcc
ggaaggcgttagagaccctccgacgggtcggggacggggtacagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaatgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaa
ctggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaggctgca
tcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|G1LIC9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL-2 (length=705 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgctcccccgggggccgcccccgcgccgggcatcttctcctcccagcccg
ggcgcacccccgcgcccgccaggacctcgccgccaccgcccccggccgcccccgccgccgccgccgccgcgggccctgcg
ctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgactt
cgcggagatgtccagccagctgcacctgacacccttcaccgcaaggggacgctttgccacggtggtggaggagctcttca
gggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggag
atgtcgcccctggtggacaacattgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggacaa
cggaggctgggatgcctttgtggagttgtacggccccagcatgcagcctctgtttgacttctcctggctgtctctgaagg
ccctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctacctgggccacaagtga
© 1998-2021Legal notice