Dataset for CDS BCL-2-like of organism Ailuropoda melanoleuca

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1LIC9_BCL2-01      atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccac
G1L3L7_MCL1-01      atgtttggcctcaaaagaa------------------acgcagtaatcggactcaacctc
G1L3L7_MCL1-02      atgtttggcctcaaaagaa------------------acgcagtaatcggactcaacctc
                    ***     *      ****                  *   *** **      ** ** *

G1LIC9_BCL2-01      tataagctgtcgcagaggggctacgagtgggatgccggagacgcgggcgccgctcccccg
G1L3L7_MCL1-01      ta-------ctgtgggggggc--cgggttgggggccggcagcggcggcgccgcctcatcg
G1L3L7_MCL1-02      ta-------ctgtgggggggc--cgggttgggggccggcagcggcggcgccgcctcatcg
                    **         *  * *****  ** ** **  *****   **  ********  *  **

G1LIC9_BCL2-01      ggggccgcccccgcgccgggcatcttct--------------------------------
G1L3L7_MCL1-01      gga--------------gggcggcttttggcttcggggaaggaggccacggcccggaggg
G1L3L7_MCL1-02      gga--------------gggcggctttt--------------------------------
                    **               ****  *** *                                

G1LIC9_BCL2-01      ------------------------------------------------------------
G1L3L7_MCL1-01      agatagggggaggggaagccggtgcggtgattggcggaagcgccggcgctagtcccccgg
G1L3L7_MCL1-02      ------------------------------------------------------------
                                                                                

G1LIC9_BCL2-01      --cctcccagcccgggcgcac---------------------------------------
G1L3L7_MCL1-01      ccactctcgcgccggacgcccggagggtcgcgcggccctcgcccattggcgccgagggtc
G1L3L7_MCL1-02      ------------------------------------------------------------
                                                                                

G1LIC9_BCL2-01      ----------------------------------ccccgcgcccgccaggacctcgccgc
G1L3L7_MCL1-01      ccgacgtcacggcgacccccccgaggctactgttcctcgagcccacccgccgcgcgtcgc
G1L3L7_MCL1-02      ------------------------------------------------------------
                                                                                

G1LIC9_BCL2-01      cacc--------------------------------------------------------
G1L3L7_MCL1-01      cgcctgaagagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctgg
G1L3L7_MCL1-02      ------------------------------------------------------------
                                                                                

G1LIC9_BCL2-01      ----------------------------gcccccggccgccc------------------
G1L3L7_MCL1-01      acgggtacgagccggaacctttggggaagcggccggctgtcctgcctttgctggagttgg
G1L3L7_MCL1-02      ------------------------------------------------------------
                                                                                

G1LIC9_BCL2-01      ------------------------------------------------------------
G1L3L7_MCL1-01      tcggggaggccagcggtggcccttgtacggacggctcactgccctcgacgccacccccag
G1L3L7_MCL1-02      ------------------------------------------------------------
                                                                                

G1LIC9_BCL2-01      ------------------------------------------------------------
G1L3L7_MCL1-01      cagaggaggaggaagacgagttgtaccggcagtcgctggagattatctctcggtaccttc
G1L3L7_MCL1-02      ------------------------------------------------------------
                                                                                

G1LIC9_BCL2-01      ---------ccgccgccgccgccgccgcgggccctgcgctcagccccgtgccacctgtgg
G1L3L7_MCL1-01      gggagcaggcaacaggcgccaaggacgcgaaaccgctgggcgggtctggg------gcgg
G1L3L7_MCL1-02      -------ggcaacaggcgccaaggacgcgaaaccgctgggcgggtctggg------gcgg
                             *  * * ****   * ****   **   *  * *  * * *      * **

G1LIC9_BCL2-01      tccacct------------gaccctgcgccaggccggcgatgacttctcccgtcgctacc
G1L3L7_MCL1-01      ccagccggaaggcgttagagaccctccgacgggtcggggacgg-----------ggtaca
G1L3L7_MCL1-02      ccagccggaaggcgttagagaccctccgacgggtcggggacgg-----------ggtaca
                     *  **             ****** ** * ** *** ** *            * *** 

G1LIC9_BCL2-01      gccgcgacttcgcggagatgtccagccag---ctgcacctgacacccttcaccgcaa--g
G1L3L7_MCL1-01      g-cgcaaccac---gagacggccttccaaggcatgcttcggaaactggacatcaaaaatg
G1L3L7_MCL1-02      g-cgcaaccac---gagacggccttccaaggcatgcttcggaaactggacatcaaaaatg
                    * *** **  *   **** * **  ***     ***  * ** **    ** *  **  *

G1LIC9_BCL2-01      gggacg---------ctttgccacg-gtggtggaggagctcttcagggatggggt---ga
G1L3L7_MCL1-01      aagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaa
G1L3L7_MCL1-02      aagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaa
                      ****         ***** * ** *** ***   *  * ***** ** ** **    *

G1LIC9_BCL2-01      actgggggaggattgtggccttctttgagttcgg------tggggtcatgtgtgtggaga
G1L3L7_MCL1-01      actggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaaga
G1L3L7_MCL1-02      actggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaaga
                    ******* ********* *  *  **   ** **      ** ** **      ** ***

G1LIC9_BCL2-01      gcgtcaaccgggag------atgtcgcccctggtggacaacattgccctgtggatgac--
G1L3L7_MCL1-01      gtataaaccaagaaggctgcatcgaaccattagcagaaagcatcac-----agatgttct
G1L3L7_MCL1-02      gtataaaccaagaaggctgcatcgaaccattagcagaaagcatcac-----agatgttct
                    *  * ****  **       **    **  * *  ** * ***  *      ****    

G1LIC9_BCL2-01      --tgagtacctgaaccggcacctgcacacctggatccaggacaacggaggctgggatgcc
G1L3L7_MCL1-01      cgtaaggac--aaaacgagactggctagtc--------aaacaa-agaggctgggatggg
G1L3L7_MCL1-02      cgtaaggac--aaaacgagactggctagtc--------aaacaa-agaggctgggatggg
                      * ** **   ** **  **  **    *          ****  ************  

G1LIC9_BCL2-01      tttgtggagttgtac--------ggccccagcatgcagcctctgtttgacttctcctggc
G1L3L7_MCL1-01      tttgtggagttcttccatgtagaggacctagaaggtggcatc----agaaatgtgctgct
G1L3L7_MCL1-02      tttgtggagttcttccatgtagaggacctagaaggtggcatc----agaaatgtgctgct
                    *********** * *        ** ** ** * *  ** **     **  * * ***  

G1LIC9_BCL2-01      tgtctctgaaggccctgctcagtctggccctggtgggagcttgcatcaccctgggtgcct
G1L3L7_MCL1-01      ggcttttgcaggtgttgctgg----------agtaggagctggttt---------ggcat
G1L3L7_MCL1-02      ggcttttgcaggtgttgctgg----------agtaggagctggttt---------ggcat
                     *  * ** ***   ****             ** ****** *  *          ** *

G1LIC9_BCL2-01      acctgggccacaagtga-
G1L3L7_MCL1-01      atcta----ataagatag
G1L3L7_MCL1-02      atcta----ataagatag
                    * **     * ***  * 

© 1998-2022Legal notice