Dataset for CDS BCL-2-like of organism Ailuropoda melanoleuca

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1LIJ8_BCL2A1-01        atg-----cac-------acagaaattccaccggcctccacgcct-----
G1LKF5_BCL2L2-01        atggcgaccccagcttcagccccagacacacgggctctagtggca-----
G1LKF5_BCL2L2-02        atggcgaccccagcttcagccccagacacacgggctctagtggca-----
G1LIC9_BCL2-01          atggcgcacgc-------t----gggagaacagggtatgataaccgggag
A0A7N5JVN3_BCL2L10      atggcggacgc-------gttgagggagcgcacggcgcggctgct-----
G1L3L7_MCL1-01          atgtttggc-c-------tcaaaagaaacgcagtaatcgg--act-----
G1L3L7_MCL1-02          atgtttggc-c-------tcaaaagaaacgcagtaatcgg--act-----
                        ***     * *                   *            *      

G1LIJ8_BCL2A1-01        ------------cccatgagtcacggtcccagccccgcaggcactcgcct
G1LKF5_BCL2L2-01        ---------gactttgtaggctataagctgaggcagaaaggt---tatgt
G1LKF5_BCL2L2-02        ---------gactttgtaggctataagctgaggcagaaaggt---tatgt
G1LIC9_BCL2-01          atagtgatgaagtacatccactataagctgtcgcagaggggc---tacga
A0A7N5JVN3_BCL2L10      --------------gaccgactac---------ctggagtac---tgcgc
G1L3L7_MCL1-01          --------------caacctctac---------tgtgggggg---gccgg
G1L3L7_MCL1-02          --------------caacctctac---------tgtgggggg---gccgg
                                              *                           

G1LIJ8_BCL2A1-01        atttggcctcggct-gctggcggcggagcaga------------------
G1LKF5_BCL2L2-01        gtgtggagctggcc--ctggggagggcccagcagctgacccactgcacca
G1LKF5_BCL2L2-02        gtgtggagctggcc--ctggggagggcccagcagctgacccactgcacca
G1LIC9_BCL2-01          gtgggatgccggag-----acgcgggcgccg-------------------
A0A7N5JVN3_BCL2L10      ccgggagcccggcacccctgcgcgggcgccgt------------------
G1L3L7_MCL1-01          gttgggggccggca-----gcggcggcgccgc------------------
G1L3L7_MCL1-02          gttgggggccggca-----gcggcggcgccgc------------------
                            *     **         *  **  * *                   

G1LIJ8_BCL2A1-01        -------cggccggctggc-------------------------------
G1LKF5_BCL2L2-01        agccatgcgggcagctggagatgagtttgagacacgcttc----------
G1LKF5_BCL2L2-02        agccatgcgggcagctggagatgagtttgagacacgcttc----------
G1LIC9_BCL2-01          --ctcccccgggggccgcccccgcg-------------------------
A0A7N5JVN3_BCL2L10      --ccacgcccgaggccg---------------------------------
G1L3L7_MCL1-01          --ctcatcgggagggcggcttttggcttcggggaaggaggccacggcccg
G1L3L7_MCL1-02          --ctcatcgggagggcggctttt---------------------------
                               *     *  *                                 

G1LIJ8_BCL2A1-01        ------------------------cagcggggcgggtggaagatgacaga
G1LKF5_BCL2L2-01        ------------------------cggcgcaccttctctgatttggcagc
G1LKF5_BCL2L2-02        ------------------------cggcgcaccttctctgatttggcagc
G1LIC9_BCL2-01          ------------------------ccgggcatcttctc----ctcccagc
A0A7N5JVN3_BCL2L10      ------------------------cggtgctgcgttcg----gtggccgc
G1L3L7_MCL1-01          gagggagatagggggaggggaagccggtgcggtgattg----gcggaagc
G1L3L7_MCL1-02          --------------------------------------------------
                                                                          

G1LIJ8_BCL2A1-01        ctgcgagttcgggtacac--------------------------------
G1LKF5_BCL2L2-01        c--------cagctgcat--------------------gtgaccccaggc
G1LKF5_BCL2L2-02        c--------cagctgcat--------------------gtgaccccaggc
G1LIC9_BCL2-01          c--------cgggcgcac--------------------------------
A0A7N5JVN3_BCL2L10      c--------caggtacag--------------------------------
G1L3L7_MCL1-01          g--------ccggcgctagtcccccggccactctcgcgccggacgcccgg
G1L3L7_MCL1-02          --------------------------------------------------
                                                                          

G1LIJ8_BCL2A1-01        --------cctgacgctggcccaggactacgtgaagcacgtcctgcagat
G1LKF5_BCL2L2-01        tcagcccagcaacgcttcacccaggtctctgatgaactcttccaaggggg
G1LKF5_BCL2L2-02        tcagcccagcaacgcttcacccaggtctctgatgaactcttccaaggggg
G1LIC9_BCL2-01          ------------------ccccgcgcccgccaggacctc----------g
A0A7N5JVN3_BCL2L10      --------------------------------------c----------a
G1L3L7_MCL1-01          agggtcgcgcggccctcgcccattggcgccgagggtccc----------g
G1L3L7_MCL1-02          --------------------------------------------------
                                                                          

G1LIJ8_BCL2A1-01        cccgca----------------------gccgggctcggcccccagcagg
G1LKF5_BCL2L2-01        ccccaactggggccgcctggtggccttctttgtctttggagccgcactgt
G1LKF5_BCL2L2-02        ccccaactggggccgcctggtggccttctttgtctttggagccgcactgt
G1LIC9_BCL2-01          ccgccaccg------------------------------cccccggccgc
A0A7N5JVN3_BCL2L10      gcgtcacga-------------------gcgcttcttgtccgattaccgc
G1L3L7_MCL1-01          acgtcacggcgacccccccgaggctactgttcctcgagcccacccgccgc
G1L3L7_MCL1-02          --------------------------------------------------
                                                                          

G1LIJ8_BCL2A1-01        g-------------------------------------------------
G1LKF5_BCL2L2-01        g-------------------------------------------------
G1LKF5_BCL2L2-02        g-------------------------------------------------
G1LIC9_BCL2-01          --------------------------------------------------
A0A7N5JVN3_BCL2L10      --------------------------------------------------
G1L3L7_MCL1-01          gcgtcgccgcctgaagagatggaaggcccagccgccgacgccatcatgtc
G1L3L7_MCL1-02          --------------------------------------------------
                                                                          

G1LIJ8_BCL2A1-01        --------------------------------------------------
G1LKF5_BCL2L2-01        --------------------------------------------------
G1LKF5_BCL2L2-02        --------------------------------------------------
G1LIC9_BCL2-01          --------------------------------------------------
A0A7N5JVN3_BCL2L10      --------------------------------------------------
G1L3L7_MCL1-01          gcccgaagaggagctggacgggtacgagccggaacctttggggaagcggc
G1L3L7_MCL1-02          --------------------------------------------------
                                                                          

G1LIJ8_BCL2A1-01        --------------------------------------------------
G1LKF5_BCL2L2-01        --------------------------------------------------
G1LKF5_BCL2L2-02        --------------------------------------------------
G1LIC9_BCL2-01          --------------------------------------------------
A0A7N5JVN3_BCL2L10      --------------------------------------------------
G1L3L7_MCL1-01          cggctgtcctgcctttgctggagttggtcggggaggccagcggtggccct
G1L3L7_MCL1-02          --------------------------------------------------
                                                                          

G1LIJ8_BCL2A1-01        --------------------------------------------------
G1LKF5_BCL2L2-01        --------------------------------------------------
G1LKF5_BCL2L2-02        --------------------------------------------------
G1LIC9_BCL2-01          --------------------------------------------------
A0A7N5JVN3_BCL2L10      --------------------------------------------------
G1L3L7_MCL1-01          tgtacggacggctcactgccctcgacgccacccccagcagaggaggagga
G1L3L7_MCL1-02          --------------------------------------------------
                                                                          

G1LIJ8_BCL2A1-01        --------------------------------------------------
G1LKF5_BCL2L2-01        --------------------------------------------------
G1LKF5_BCL2L2-02        --------------------------------------------------
G1LIC9_BCL2-01          --------------------------------------------------
A0A7N5JVN3_BCL2L10      --------------------------------------------------
G1L3L7_MCL1-01          agacgagttgtaccggcagtcgctggagattatctctcggtaccttcggg
G1L3L7_MCL1-02          --------------------------------------------------
                                                                          

G1LIJ8_BCL2A1-01        ----cgtcccaggtgc---------------------tgcgggac-----
G1LKF5_BCL2L2-01        ----tgctgagagtgtcaacaaagagatggaaccacttgtgggacaagtg
G1LKF5_BCL2L2-02        ----tgctgagagtgtcaacaaagagatggaaccacttgtgggacaagtg
G1LIC9_BCL2-01          ----ccccgccgccgccgccgc---------------cgcgggccctgcg
A0A7N5JVN3_BCL2L10      ----ggctac-ggcggcaaccg---------------cgtggagctggtg
G1L3L7_MCL1-01          agcaggcaacaggcgccaagga---------------cgcgaaaccgctg
G1L3L7_MCL1-02          ----ggcaacaggcgccaagga---------------cgcgaaaccgctg
                                      *                       * *   *     

G1LIJ8_BCL2A1-01        ------------------gtggcct-cctccgtgcagg------------
G1LKF5_BCL2L2-01        caagagtggatg------gtggcctacctggagacacg----gctggctg
G1LKF5_BCL2L2-02        caagagtggatg------gtggcctacctggagacacg----gctggctg
G1LIC9_BCL2-01          ctcagccccgtgccacctgtggtccacctg------------accctgcg
A0A7N5JVN3_BCL2L10      g------ctcag------gtgg----------agcgggagatactcgccc
G1L3L7_MCL1-01          ggcgggtctggg------gcggccagccggaaggcgttagagaccctccg
G1L3L7_MCL1-02          ggcgggtctggg------gcggccagccggaaggcgttagagaccctccg
                                          * **                            

G1LIJ8_BCL2A1-01        -------------gggaggtggaaaagaacttgaaaccatgcctggacag
G1LKF5_BCL2L2-01        actggatccacagcagtgggggctgggagctggaagcgatcaaagctcga
G1LKF5_BCL2L2-02        actggatccacagcagtgggggctgggagctggaagcgatcaaagctcga
G1LIC9_BCL2-01          cc-----------aggccggcgatgacttctcc-cgtcgctaccgccgcg
A0A7N5JVN3_BCL2L10      acccccagcccctaagctggggccgtgtggtgg-cgctct-------tga
G1L3L7_MCL1-01          ac-----------gggtcggggacggggtacag-cgcaaccacgagacgg
G1L3L7_MCL1-02          ac-----------gggtcggggacggggtacag-cgcaaccacgagacgg
                                       *  *  *                            

G1LIJ8_BCL2A1-01        ttttgatg----------------------------tggtgtccgtcgac
G1LKF5_BCL2L2-01        g--tcagggagatggaggaagaagctgagaagctaaaggagctacagaac
G1LKF5_BCL2L2-02        g--tcagggagatggaggaagaagctgagaagctaaaggagctacagaac
G1LIC9_BCL2-01          acttcgcggagatgtccagccagct------gcacctgacacccttcacc
A0A7N5JVN3_BCL2L10      ccttcgcgggca------------c------actgctgga----gagatc
G1L3L7_MCL1-01          ccttccaaggca------------t------gcttcggaaactggacatc
G1L3L7_MCL1-02          ccttccaaggca------------t------gcttcggaaactggacatc
                           *                                 *           *

G1LIJ8_BCL2A1-01        tccgccaga------accatattcaatca--------g--gtcatggaaa
G1LKF5_BCL2L2-01        gaggtagagaaacagatgaatatgagtccacctccaggcaatgctggccc
G1LKF5_BCL2L2-02        gaggtagagaaacagatgaatatgagtccacctccaggcaatgctggccc
G1LIC9_BCL2-01          gcaa--ggg-----gacg---------ctttgccac-g--gtggtggagg
A0A7N5JVN3_BCL2L10      gccgtcggg-----gacctactcgaacct--------g--gggccggacc
G1L3L7_MCL1-01          aaaaatgaa-----gacgatgtcaaatctttgtctcga--gtgatggtcc
G1L3L7_MCL1-02          aaaaatgaa-----gacgatgtcaaatctttgtctcga--gtgatggtcc
                                       *           *                 **   

G1LIJ8_BCL2A1-01        aggaatttgaagacggcatcattaactgggga---aggattgtgaccata
G1LKF5_BCL2L2-01        agtgatcatgtctattgaagagaagatggaggctgatgcccgttccatct
G1LKF5_BCL2L2-02        agtgatcatgtctattgaagagaagatggaggctgatgcccgttccatct
G1LIC9_BCL2-01          agctcttcagggatggggtg---aactggggg---aggattgtggccttc
A0A7N5JVN3_BCL2L10      agg--------------------aactggagctgggggagtggga-----
G1L3L7_MCL1-01          atgttttcagtgacggagtaacaaactggggc---aggattgtgactctt
G1L3L7_MCL1-02          atgttttcagtgacggagtaacaaactggggc---aggattgtgactctt
                        *                      *  *** *      *   *        

G1LIJ8_BCL2A1-01        tttgcgtttgaagggattctcacc---------aagaaa-----------
G1LKF5_BCL2L2-01        atgttggcaacgtggactatggtgcaacagcagaagagctggaagcacac
G1LKF5_BCL2L2-02        atgttggcaacgtggactatggtgcaacagcagaagagctggaagcacac
G1LIC9_BCL2-01          tttgagttcggtgg------ggtcatgtgtgtggagagc-----------
A0A7N5JVN3_BCL2L10      --------------------ggcc------------ggc-----------
G1L3L7_MCL1-01          atttcttttggtgcctttgtggccaaacacttgaagagt-----------
G1L3L7_MCL1-02          atttcttttggtgcctttgtggccaaacacttgaagagt-----------
                                                                          

G1LIJ8_BCL2A1-01        ------------------ctcctccggg----------------------
G1LKF5_BCL2L2-01        tttcatggctgtggttcagtcaatcgtgttaccatactctgtgacaaatt
G1LKF5_BCL2L2-02        tttcatggctgtggttcagtcaatcgtgttaccatactctgtgacaaatt
G1LIC9_BCL2-01          ------------------gtcaaccggg-----agatgtcg-------cc
A0A7N5JVN3_BCL2L10      ------------------gtccgccagg-----a-ctgccg----gcacc
G1L3L7_MCL1-01          ------------------ataaaccaag-----a-aggctgcatcgaacc
G1L3L7_MCL1-02          ------------------ataaaccaag-----a-aggctgcatcgaacc
                                           *    *  *                      

G1LIJ8_BCL2A1-01        ---agcgaatttccc-------------------------cagatgtgga
G1LKF5_BCL2L2-01        --tagtggccatcctaaagggtttgcatatatagagttctcagataaaga
G1LKF5_BCL2L2-02        --tagtggccatcctaaagggtttgcatatatagagttctcagataaaga
G1LIC9_BCL2-01          cctggtggacaacat-----------------------------------
A0A7N5JVN3_BCL2L10      --tggtggacttcct-----------------------------------
G1L3L7_MCL1-01          attagcagaaagcat-----------------------------------
G1L3L7_MCL1-02          attagcagaaagcat-----------------------------------
                            *       *                                     

G1LIJ8_BCL2A1-01        cgcttctaggatttcttacttcgtggcggagttcat--------------
G1LKF5_BCL2L2-01        gtcagtgaggacttccttggccttagatgagtccctatttagaggaagac
G1LKF5_BCL2L2-02        gtcagtgaggacttccttggccttagatgagtccctatttagaggaagac
G1LIC9_BCL2-01          ------------tgccctgtggatgactgagtacct--------------
A0A7N5JVN3_BCL2L10      ------------ctgc------------aatcggct--------------
G1L3L7_MCL1-01          ------------caca------------gatgttct--------------
G1L3L7_MCL1-02          ------------caca------------gatgttct--------------
                                                     *     *              

G1LIJ8_BCL2A1-01        ---------------cacgacaaacatgagagagtggataaggcagaacg
G1LKF5_BCL2L2-01        aaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcaccac-
G1LKF5_BCL2L2-02        aaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcaccac-
G1LIC9_BCL2-01          ---------------gaaccggcacctgcacacctggatccaggacaacg
A0A7N5JVN3_BCL2L10      ---------------cacgggacagcatcgcgcctggctggaggcgcacg
G1L3L7_MCL1-01          ---------------cgtaaggacaaaacgagactggctagtcaaacaaa
G1L3L7_MCL1-02          ---------------cgtaaggacaaaacgagactggctagtcaaacaaa
                                                           **          *  

G1LIJ8_BCL2A1-01        gaggctgggaagacggctttgtaaagaagttcgaacc-------------
G1LKF5_BCL2L2-01        -agaccgg---ggt-----------ttcccacgagcccgataccgtg---
G1LKF5_BCL2L2-02        -agaccgg---ggt-----------ttcccacgagcccgataccgtg---
G1LIC9_BCL2-01          gaggctgg---gatgcctttgtggagttgtacggccccagcatgcag---
A0A7N5JVN3_BCL2L10      acggctgg---gatggcttttgtctcttcttcacacc---catgctg---
G1L3L7_MCL1-01          gaggctgg---gatgggtttgtggagttctt-----c---catgtagagg
G1L3L7_MCL1-02          gaggctgg---gatgggtttgtggagttctt-----c---catgtagagg
                          * * **   *                        *             

G1LIJ8_BCL2A1-01        --------------------caagtctggc--------------tggct-
G1LKF5_BCL2L2-01        -cccggaccaccaactacaacagttcccgctctcgattctacagtggttt
G1LKF5_BCL2L2-02        -cccggaccaccaactacaacagttcccgctctcgattctacagtggttt
G1LIC9_BCL2-01          -cctc--------tgtttgacttctcctgg--------------ctgtct
A0A7N5JVN3_BCL2L10      -cc------gtcgtcttggaaaag-actgc--------------tggcc-
G1L3L7_MCL1-01          acctagaaggtggcatcagaaatgtgctgc--------------tggctt
G1L3L7_MCL1-02          acctagaaggtggcatcagaaatgtgctgc--------------tggctt
                                                    *                 *   

G1LIJ8_BCL2A1-01        --------gacttttctgg---aagttacggggaagatctg--------t
G1LKF5_BCL2L2-01        taacagcaggccccggggtcgcgtctacaggggccgggctagagcgacat
G1LKF5_BCL2L2-02        taacagcaggccccggggtcgcgtctacaggggccgggctagagcgacat
G1LIC9_BCL2-01          ---ctgaaggccctgctcagtctggccctggtgg-gagcttgcatcac-c
A0A7N5JVN3_BCL2L10      ------caggctcttctgtcctgcttcacagcggtgatcttaa-------
G1L3L7_MCL1-01          ---ttgcaggtgttgctgg----------agtag-gagctggt-------
G1L3L7_MCL1-02          ---ttgcaggtgttgctgg----------agtag-gagctggt-------
                                *                     *    *  **          

G1LIJ8_BCL2A1-01        gaaatgttctctctcctgaagcaatactgctga
G1LKF5_BCL2L2-01        catggt------ttctgtag-------------
G1LKF5_BCL2L2-02        catggtattccccttactaa-------------
G1LIC9_BCL2-01          ctgggtgcctacctgggccacaagtga------
A0A7N5JVN3_BCL2L10      -------tctacttctggaaaaggttattgtga
G1L3L7_MCL1-01          -------ttggcatatctaataagatag-----
G1L3L7_MCL1-02          -------ttggcatatctaataagatag-----
                                     *                   

© 1998-2022Legal notice