Dataset for CDS BAX-like of Organism Leptobrachium leishanense

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5MG88_BOK-01      atggagatgctacg------------ccgctcatcggtttttgctg----
A0A8C5PKU5_BAX-03      atggcggagaaaggagccggcggggactggccatctgtgtgcgaaggagc
A0A8C5PKU5_BAX-04      atggcggagaaaggagccggcggggactggccatctgtgtgcgaaggagc
A0A8C5PKU5_BAX-01      atggcggagaaaggagccggcggggactggccatctgtgtgcgaaggagc
A0A8C5PKU5_BAX-02      atgat----------accgctctggatt----------------------
                       ***                                               

A0A8C5MG88_BOK-01      -----------------ctgaagtttttgaggcctttgacagatccccca
A0A8C5PKU5_BAX-03      cacggggggagagaacccggaagc------ggccggcaacggaagccgaa
A0A8C5PKU5_BAX-04      cacggggggagagaacccggaagc------ggccggcaacggaagccgaa
A0A8C5PKU5_BAX-01      cacggggggagagaacccggaagc------ggccggcaacggaagccgaa
A0A8C5PKU5_BAX-02      -----------------tggatgc------ttctgggggctg--------
                                          ** *         *      * *        

A0A8C5MG88_BOK-01      cag---------------acaagg-------agttggtt--tcgcaggga
A0A8C5PKU5_BAX-03      cag-------------ggacaagcacagaacagattgtgga-gacgggga
A0A8C5PKU5_BAX-04      cag-------------ggacaagcacagaacagattgtgga-gacgggga
A0A8C5PKU5_BAX-01      cagctgcggcaccgctggatgatgaca----agatcatcaatggctatga
A0A8C5PKU5_BAX-02      cagctgcggcaccgctggatgatgaca----agatcatcaatggctatga
                       ***               *  *         ** *  *      *   **

A0A8C5MG88_BOK-01      aaggccctctgcagggactatatccaggctcggcttctaagagctaactt
A0A8C5PKU5_BAX-03      acgtgctgct-----caat------------gggttc--attgctgacca
A0A8C5PKU5_BAX-04      acgtgctgct-----caat------------gggttc--attgctgacca
A0A8C5PKU5_BAX-01      atgtccccgt-----cactcccagccgtggcaggtgt--atttc--acct
A0A8C5PKU5_BAX-02      atgtccccgt-----cactcccagccgtggcaggtgt--atttc--acct
                       * *  *   *      * *             * *    *   *  **  

A0A8C5MG88_BOK-01      gggatggagcaagccggagcacggcatatcttccacgtctgttggccgca
A0A8C5PKU5_BAX-03      agttcagaggacacca------aatagacctactg-atgcattggcagag
A0A8C5PKU5_BAX-04      agttcagaggacacca------aatagacctactg-atgcattggcagag
A0A8C5PKU5_BAX-01      ataaaggtgaacgctggtg--cggcgggtct-ctg-atcaattcacaatg
A0A8C5PKU5_BAX-02      ataaaggtgaacgctggtg--cggcgggtct-ctg-atcaattcacaatg
                             * * *  *               ** *    *   **  *    

A0A8C5MG88_BOK-01      -------------------------------tggctgaggtatcggacac
A0A8C5PKU5_BAX-03      cttggggtgcagtcagctccggcggaccctcggacaaaggaactcagtga
A0A8C5PKU5_BAX-04      cttggggtgcagtcagctccggcggaccctcggacaaaggaactcagtga
A0A8C5PKU5_BAX-01      ----------gatcatctcagcagcacattgttacaaatcacccaagtat
A0A8C5PKU5_BAX-02      ----------gatcatctcagcagcacattgttacaaatcacccaagtat
                                                         *  *            

A0A8C5MG88_BOK-01      tttcctga---ggctaggggatgagctg---gaatacatgaggccagccg
A0A8C5PKU5_BAX-03      gtgcctgcgtaaaattggagatgaactggatggaaacatggagcta----
A0A8C5PKU5_BAX-04      gtgcctgcgtaaaattggagatgaactggatggaaacatggagcta----
A0A8C5PKU5_BAX-01      ttaattgc-tcatcttg--------------gggaacatgacacca----
A0A8C5PKU5_BAX-02      ttaattgc-tcatcttg--------------gggaacatgacacca----
                        *   **       * *              *   *****   * *    

A0A8C5MG88_BOK-01      tgtacagaaacatcgcccggcaactgaatatctccctcg-----------
A0A8C5PKU5_BAX-03      --cagagaatgattgaacaggtacaaagcgattctcccaag-gaag----
A0A8C5PKU5_BAX-04      --cagagaatgattgaacaggtacaaagcgattctcccaag-gaag----
A0A8C5PKU5_BAX-01      --caaaggaaga------aggaacagagcaacatattcaagtgaagaacg
A0A8C5PKU5_BAX-02      --caaaggaaga------aggaacagagcaacatattcaagtgaagaacg
                          * ** *  *       *  **  *          *            

A0A8C5MG88_BOK-01      ----------cttctgagaccgtgctgtctg--------acgcattcctg
A0A8C5PKU5_BAX-03      ----------tctttttcaaagtagcatccgaa------atgttttc-tg
A0A8C5PKU5_BAX-04      ----------tctttttcaaagtagcatccgaa------atgttttc-tg
A0A8C5PKU5_BAX-01      catatcaatatttctactataacaacaattacatggaccacgacttcatg
A0A8C5PKU5_BAX-02      catatcaatatttctactataacaacaattacatggaccacgacttcatg
                                   * *   *                    * *  *** **

A0A8C5MG88_BOK-01      gcggtgg---cagctgagatcttcacagcaggtatcacatgggggaaggt
A0A8C5PKU5_BAX-03      atgggaattttaactggggcc----------------------gagtggt
A0A8C5PKU5_BAX-04      atgggaattttaactggggcc----------------------gagtggt
A0A8C5PKU5_BAX-01      atggtgaaattagcagagcca----------------------gcacagt
A0A8C5PKU5_BAX-02      atggtgaaattagcagagcca----------------------gcacagt
                         **       * * * *                         *    **

A0A8C5MG88_BOK-01      ggtgtccttatatgcagt-------ggcggccggt---------------
A0A8C5PKU5_BAX-03      cgcgctcttctattttgct--tcaaggcttattataaagcaccaatgtcc
A0A8C5PKU5_BAX-04      cgcgctcttctattttgct--tcaaggcttattata--------------
A0A8C5PKU5_BAX-01      tcaaccaatacgtgcagcccatcaaagtagccagtagttgtccaa-----
A0A8C5PKU5_BAX-02      tcaaccaatacgtgcagcccatcaaagtagccagtagttgtccaa-----
                               *   *   *         *       *               

A0A8C5MG88_BOK-01      --------------------------ctagcagt-----------ggact
A0A8C5PKU5_BAX-03      acttgacacatttataatgagccatgctgctactcccctcgtttgccacg
A0A8C5PKU5_BAX-04      --------------------------------------------------
A0A8C5PKU5_BAX-01      --------------------------ctgccagtactcagtgtctggtgt
A0A8C5PKU5_BAX-02      --------------------------ctgccagtactcagtgtctggtgt
                                                                         

A0A8C5MG88_BOK-01      gtgtgaagcagtctcagccggcctatgttct----------------cac
A0A8C5PKU5_BAX-03      ccgtgggcaaggccttgttgacaaacgttccaaaaattacccgt-accat
A0A8C5PKU5_BAX-04      --------aaggccttgttgacaaacgttccaaaaattacccgt-accat
A0A8C5PKU5_BAX-01      ctggatgggggaacctgctgacatctggtgtgaagtatcctgatggcctc
A0A8C5PKU5_BAX-02      ctggatgggggaacctgctgacatctggtgtgaagtatcctgatggcctc
                                 *     *  * *    * *                  *  

A0A8C5MG88_BOK-01      cattg--tgga----------ctgcttgggggaatttgtaaggaagac--
A0A8C5PKU5_BAX-03      cattgattgga---------------caatggaa----------------
A0A8C5PKU5_BAX-04      cattgattgga---------------caatggaa----------------
A0A8C5PKU5_BAX-01      cagtgtttggagatccccgttctctccgaggaaagctgcaaagcgtctta
A0A8C5PKU5_BAX-02      cagtgtttggagatccccgttctctccgaggaaagctgcaaagcgtctta
                       ** **  ****                   * **                

A0A8C5MG88_BOK-01      ------cctggtcac-----------------ctggctgaagagaagagg
A0A8C5PKU5_BAX-03      -tactttcgagtca--------atgttgtgcagtggattcgggatcaggg
A0A8C5PKU5_BAX-04      -tactttcgagtca--------atgttgtgcagtggattcgggatcaggg
A0A8C5PKU5_BAX-01      ttcctatcaggttacttcaaacatgttctgcgccggcttc-----cagga
A0A8C5PKU5_BAX-02      ttcctatcaggttacttcaaacatgttctgcgccggcttc-----cagga
                              *  ** *                    ** *          * 

A0A8C5MG88_BOK-01      aggatggacggatgtca---ccaagtgtgttgtgacttctgat-------
A0A8C5PKU5_BAX-03      aggctgggaaaatatcatttca---tacgtcagcactcctact-------
A0A8C5PKU5_BAX-04      aggctgggaaaatatcatttca---tacgtcagcactcctact-------
A0A8C5PKU5_BAX-01      tgga-gggaaagactcgtgtcagggtgactctggaggaccactggcctgt
A0A8C5PKU5_BAX-02      tgga-gggaaagactcgtgtcagggtgactctggaggaccactggcctgt
                        **  **       **    *    *   *    *   *   *       

A0A8C5MG88_BOK-01      --------------------------------cctagttttcgatcccac
A0A8C5PKU5_BAX-03      ---------------------------tggcaaacagtttgtatct----
A0A8C5PKU5_BAX-04      ---------------------------tggcaaacagtttgtatct----
A0A8C5PKU5_BAX-01      aatggagagctttatggagtggtatcgtggggaaaaggctgcgcccagag
A0A8C5PKU5_BAX-02      aatggagagctttatggagtggtatcgtggggaaaaggctgcgcccagag
                                                          **  *          

A0A8C5MG88_BOK-01      tggttggtgtccagtgcgtgcaac------tttggccatttcctgaaggc
A0A8C5PKU5_BAX-03      --tct--tctccggtgta---------------------tt-----ag-c
A0A8C5PKU5_BAX-04      --tct--tctccggtgta---------------------tt-----ag-c
A0A8C5PKU5_BAX-01      aggtt--accccggcgtatacaccaaagtgtgcaactactt-----agac
A0A8C5PKU5_BAX-02      aggtt--accccggcgtatacaccaaagtgtgcaactactt-----agac
                           *     ** * *                       **     ** *

A0A8C5MG88_BOK-01      ggtcatctttttcctattacgtgagcggtag
A0A8C5PKU5_BAX-03      tgccgcctttaccatctggaggatgaagtga
A0A8C5PKU5_BAX-04      tgccgcctttaccatctggaggatgaagtga
A0A8C5PKU5_BAX-01      tggatcctgcatgtcattgacaatt-attaa
A0A8C5PKU5_BAX-02      tggatcctgcatgtcattgacaatt-attaa
                        *    **        *           *  

© 1998-2023Legal notice