Dataset for CDS Unclassified of organism Pan troglodytes

[Download (right click)]

5 sequence(s)

>gnl|bcl2dbcds|A0A2I3RZK3_uncBCL2A1-04 Putative BCL2-related protein A1 gene OS=[Eukaryota] Pan troglodytes (length=216 residues).
gtggcgcgatcttggctcactgcagcctcgacctccacggctcaagaaaatggctttgtaaagaagtttgaacataaatc
tggctggatgacttttctagaagttacaggaaagatctcaatactgttgaccagaaaggacactccatattgtgaaaccg
gcctaatttttctgactgttatggaaacgattgccaacacatacttctacttttaa
>gnl|bcl2dbcds|A0A2I3RZK3_uncBCL2A1-02 Putative BCL2-related protein A1 gene OS=[Eukaryota] Pan troglodytes (length=492 residues).
atgacagactgtgaatttggatatatttacaggctggctcaggactatctgcagtacgtcctacagataccacaacctgg
atcaggtccaagcaaaacgtccagagtgctacaaaatgttgcattctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtctgtagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
aattgccccggatgtggatacttataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taagacaaaacggaggctgggggaaatggcacaatcacacgcctatgctggtagagtcagtggcccacaagaagaggaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A2I3T949_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Pan troglodytes (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2I3T949_uncBCL2L1-02 Putative BCL2-like 1 gene OS=[Eukaryota] Pan troglodytes (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggatacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|H2Q9X6_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Pan troglodytes (length=240 residues).
atggcgcgatctcggctcactgcaacctctgtctcccaggttcaggaaaatggctttgtaaagaagcttgagcctaaatc
tggctggatgacttttctagaagttacaggaaagatctgtgaaatgctcttctgtcctgaagcaatactgttgaccagaa
aggacactccatattgtgaaaccggcctaatttttctgactcttatgaaaacgattgccaacacatacttctacttttaa
© 1998-2020Legal notice