Dataset for CDS BAX-like of Organism Acanthochromis polyacanthus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q1FXV2_BAX-01      atgg-------------catcg-----cacccggga--------------
A0A3Q1FSZ4_BAX-01      atgtctggcagccgagacgaggataaacccccgggagagcag--gaacct
A0A3Q1FSZ4_BAX-02      atgtctggcagccgagacgaggataaacccccgggagagcag--gaacct
A0A3Q1F1K1_BOK-01      atgg-----agatgttgcgccgct---cctctgtgtttgcggctgaa---
A0A3Q1FIY9_BOK-01      atgg-----aggtgctgcgtaggt---cctctgtgtttgctgcagaggtc
                       ***              *   *     *  * * *               

A0A3Q1FXV2_BAX-01      ------ggaggtgaccaaggaaatggcaaggaacagctagtggaagtagg
A0A3Q1FSZ4_BAX-01      caaggcg-----------ccgtcggcggagaagatgttgttgatgatccc
A0A3Q1FSZ4_BAX-02      caaggcg-----------ccgtcggcggagaagatgttgttgatgatccc
A0A3Q1F1K1_BOK-01      ------gtgtttgaccgatcacccaccgacaaggagctggtg----tccc
A0A3Q1FIY9_BOK-01      ctggatgtgtttgaccgatcgctgactgagaaggagctggtg----tccc
                             *                     *  *   * *  **    *   

A0A3Q1FXV2_BAX-01      agct----gctttgttaaaggacttcatttttgagcgggttcagcggcat
A0A3Q1FSZ4_BAX-01      atcttggagcagggagcagtggtc---------------ctcagagggta
A0A3Q1FSZ4_BAX-02      atcttggagcagggagcagtggtc---------------ctcagagggta
A0A3Q1F1K1_BOK-01      aggccaaagctctgtgcagagactaca-tccactccaggctgaaccgggc
A0A3Q1FIY9_BOK-01      agtccaaagctctgtgcagagactaca-tcctgtccagactcaaccagaa
                       *       **   *   *  *                   * *       

A0A3Q1FXV2_BAX-01      ggagatggtaatactgtagtgacaagagcacag-----------------
A0A3Q1FSZ4_BAX-01      tgtgattg-aac-gtataaacacagaagaccctagtcggcacgtctcctc
A0A3Q1FSZ4_BAX-02      tgtgattg-aac-gtataaacacagaagaccctagtcggcacgtctcctc
A0A3Q1F1K1_BOK-01      agggatcg-gctggtctaaaccc--gagcacggactggctgcg--tcagg
A0A3Q1FIY9_BOK-01      cgggctgg-gatggtctaaaact--gagatcaactttggtccg--tccaa
                        * * * *      * **        **  *                   

A0A3Q1FXV2_BAX-01      -------ctgggtggagga------gagctggttgacccaaatcataaga
A0A3Q1FSZ4_BAX-01      tgaggatctgggaggaaggccagatgaactacaggatccacaaattaaag
A0A3Q1FSZ4_BAX-02      tgaggatctgggaggaaggccagatgaactacaggatccacaaattaaag
A0A3Q1F1K1_BOK-01      tgggactctgggagaggtctcctctgtcctgctgtggct---gggtgatg
A0A3Q1FIY9_BOK-01      tgcagcgctggccgaggtgtctctggtgcttctctgtct---tggcgacg
                              ****  *           *  **       *         *  

A0A3Q1FXV2_BAX-01      agctcggtcagtgcctgcagc---agattggagatgagctggatggaaat
A0A3Q1FSZ4_BAX-01      aagtgg---tggatcagctactcaagatagctgatgacctgaacaggaac
A0A3Q1FSZ4_BAX-02      aagtgg---tggatcagctactcaagatagctgatgacctgaacaggaac
A0A3Q1F1K1_BOK-01      agttgg---aatatcttcgtccca------------acgtttatcggaac
A0A3Q1FIY9_BOK-01      agctgg---agtgtatacagccca------------gtctgtacaggaac
                       *  * *           *  *                  *  *  * ** 

A0A3Q1FXV2_BAX-01      gtggagctccagaggatgataaatgattcctcactcagtcctacaaaaga
A0A3Q1FSZ4_BAX-01      gctgagctccagcgacttatcaaccaggttcagggaaactgtgctcagga
A0A3Q1FSZ4_BAX-02      gctgagctccagcgacttatcaaccaggttcagggaaactgtgctcagga
A0A3Q1F1K1_BOK-01      gtcgcccgacagctgaacatcacagtagcttcagagagcattgtgtctga
A0A3Q1FIY9_BOK-01      gtggcgcggcagctcaacatttctgttgccatggagaacatggtttcgga
                       *  *  *  ***      **                *           **

A0A3Q1FXV2_BAX-01      tgtgtttatgaaagttgctgttgagatcttttcagatggaaaatttaact
A0A3Q1FSZ4_BAX-01      catcttcatgaaggtggccaggagcatctttgctgatggaa---taaact
A0A3Q1FSZ4_BAX-02      catcttcatgaaggtggccaggagcatctttgctgatggaa---taaact
A0A3Q1F1K1_BOK-01      tgccttcctggctgttgctgcagacattttctccacaggtg---tgacat
A0A3Q1FIY9_BOK-01      tgccttcatcggtgtggcaacggagatcttctctgcaggta---taacat
                           **  *    ** **       ** **  *    **     * *  *

A0A3Q1FXV2_BAX-01      ggggcagggtggttgctctgttctactttg--------cctgtcgactcg
A0A3Q1FSZ4_BAX-01      ggggtcgagtggtggctctctttcatctgg--------cctacagactta
A0A3Q1FSZ4_BAX-02      ggggtcgagtggtggctctctttcatctgg--------cctacagactta
A0A3Q1F1K1_BOK-01      gggggaaggtggtttccttgtatgctgtggcaggagctctggcggtggac
A0A3Q1FIY9_BOK-01      ggggtaaagtggtatccatgtacgcagtagctggagccctggcagtcgac
                       ****    *****  *  * *      * *        *     *     

A0A3Q1FXV2_BAX-01      tcattaaggctcttgtaacccaagtacctgatat-catcagaaccattat
A0A3Q1FSZ4_BAX-01      tatacaaggctc-tgaccaccaaccatttagagaacatcagaatgattat
A0A3Q1FSZ4_BAX-02      tatacaaggctc-tgaccaccaaccatttagagaacatcagaatgattat
A0A3Q1F1K1_BOK-01      tgcgttcgccac-ggtcatcctgcta--tggtccacaccattgtgg--ac
A0A3Q1FIY9_BOK-01      tgtgtcagacaa-ggccatccaacca--cagtacacatcttagtgg--ac
                       *      * *    *    **    *         ** *         * 

A0A3Q1FXV2_BAX-01      tcattggaccatggactacctccgggaacatgtgatcaactggatcaggg
A0A3Q1FSZ4_BAX-01      cagctgggttctccaattcattagagagcagctctatgtctggcttgtgc
A0A3Q1FSZ4_BAX-02      cagctgggttctccaattcattagagagcagctctatgtctggcttgtgc
A0A3Q1F1K1_BOK-01      tgcatgggg----gagtttgtccgcaagagtctgacctcctggttaaaga
A0A3Q1FIY9_BOK-01      agtctggga----cagtttgttcgcaaattcctggtgccctggctgaaaa
                           ***       * *   *  *  *     *      **** *     

A0A3Q1FXV2_BAX-01      agcaaggtggctgggagggtatt---------------------------
A0A3Q1FSZ4_BAX-01      agcagggaggctgggtgagtggtacatcatctgtaa--------------
A0A3Q1FSZ4_BAX-02      agcagggaggctgggaggggg-----tgatccgtag--------------
A0A3Q1F1K1_BOK-01      agagaggaggctgggcagatatgaccaaatgtgtggtgaacactgatccc
A0A3Q1FIY9_BOK-01      gacgagggggatgggtgagtattacaaaatgtgtggtgaagaaggatctc
                            ** ** ****                                   

A0A3Q1FXV2_BAX-01      -----cgttcccactttggtactcccacatggcagacagtgggagttttc
A0A3Q1FSZ4_BAX-01      -----agttttgtcctg------------tat--gtttgtttaaggcttt
A0A3Q1FSZ4_BAX-02      -----cttttctcgatggaggacagcagccat--agtagcatcagtagta
A0A3Q1F1K1_BOK-01      agtttccgttctcactggctggtgtctgctgtctgtgcctttggacacta
A0A3Q1FIY9_BOK-01      gctcccgaacaaaactggttctcctctactgtggagtctctcaagtactt
                                      *                                * 

A0A3Q1FXV2_BAX-01      ttggcaggcgttctcaccactgttctcgtcattcgcaagatg-------t
A0A3Q1FSZ4_BAX-01      c-------tggtctcctgcatggact--tgttcggggatccaaagttcct
A0A3Q1FSZ4_BAX-02      c-------tggtggca-acttttatt--tatctcagga---ggacacgct
A0A3Q1F1K1_BOK-01      cctgaaggccgtcgtgt---tgtacc--tcctcagggagaag-------t
A0A3Q1FIY9_BOK-01      cctga---ccacaatgtacgtctaca--tcatgaaggagccg-------t
                                           *       *        *           *

A0A3Q1FXV2_BAX-01      ga
A0A3Q1FSZ4_BAX-01      aa
A0A3Q1FSZ4_BAX-02      ga
A0A3Q1F1K1_BOK-01      ga
A0A3Q1FIY9_BOK-01      ga

© 1998-2023Legal notice