Dataset for CDS BAX of Organism Balaenoptera musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B8VVQ4_BAX-01      atgaagacaggggcccttttgcttcagggtttcatccaggatcgagcagg
A0A8B8VVQ4_BAX-02      atg--gacggg-----------tccggggagcaacccaga----------
                       ***  *** **           * * ***    * ****           

A0A8B8VVQ4_BAX-01      gcgaatggggggagagacacccgagctgggcctggagcaggcgccccagg
A0A8B8VVQ4_BAX-02      ------ggcggggggcccacc-------agctctgagcag----------
                             ** *** *   ****        **   ******          

A0A8B8VVQ4_BAX-01      atgcatccaccaagaagctgagcgagtgtctcaagcgcattggagatgaa
A0A8B8VVQ4_BAX-02      --------atcatgaagacaggggccctttt-------------------
                               * ** ****    * *    * *                   

A0A8B8VVQ4_BAX-01      ctggacagtaacatggagctgcagaggatgatcgcggccgtggacacaga
A0A8B8VVQ4_BAX-02      -----------------gcttcaggggatgatcgcggccgtggacacaga
                                        *** *** *************************

A0A8B8VVQ4_BAX-01      ctccccccgagaggtctttttccgagtggcggctgaaatgttttctgacg
A0A8B8VVQ4_BAX-02      ctccccccgagaggtctttttccgagtggcggctgaaatgttttctgacg
                       **************************************************

A0A8B8VVQ4_BAX-01      gcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaa
A0A8B8VVQ4_BAX-02      gcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaa
                       **************************************************

A0A8B8VVQ4_BAX-01      ctggtgctcaaggccctgtgcaccaaggtgccccagctgatcaggaccat
A0A8B8VVQ4_BAX-02      ctggtgctcaaggccctgtgcaccaaggtgccccagctgatcaggaccat
                       **************************************************

A0A8B8VVQ4_BAX-01      catgggctggacactggacttccttcgagagcggctgctgggctggatcc
A0A8B8VVQ4_BAX-02      catgggctggacactggacttccttcgagagcggctgctgggctggatcc
                       **************************************************

A0A8B8VVQ4_BAX-01      aggaccagggtggttgggacggcctcctctcctactttgggacacccacg
A0A8B8VVQ4_BAX-02      aggaccagggtggttgggacggcctcctctcctactttgggacacccacg
                       **************************************************

A0A8B8VVQ4_BAX-01      tggcagacagtgaccatcttcgtggccggcgtgctcactgcctcgcttac
A0A8B8VVQ4_BAX-02      tggcagacagtgaccatcttcgtggccggcgtgctcactgcctcgcttac
                       **************************************************

A0A8B8VVQ4_BAX-01      catctggaagaagatgggctga
A0A8B8VVQ4_BAX-02      catctggaagaagatgggctga
                       **********************

© 1998-2023Legal notice