Dataset for CDS BAX-like of Organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6PMP8_BAK1-03      atggc---atccgggcaa-ggcccagggcctcccaggcgggagtgtggagaggctgcccc
F6PMP8_BAK1-01      atggc---atccgggcaa-ggcccagggcctcccaggcgggagtgtggagaggctgcccc
F6PMP8_BAK1-02      atggc---atccgggcaa-ggcccagggcctcccaggcgggagtgtggagaggctgcccc
Q52HB2_BAK1-01      atggc---atccgggcaa-ggcccagggcctcccaggcgggagtgtggagaggctgcccc
F1PAN9_BAX-01       atggacgggtccggggagcaacccag--------aggcggggg-----------------
Q8HYU5_BAX-01       atggacgggtccggggagcaacccag--------aggcggggg-----------------
                    ****     ****** *    *****        ******* *                 

F6PMP8_BAK1-03      gtcttctacttctgag--gagcaggtagcccgggacaccgaggaggttttccgcagctat
F6PMP8_BAK1-01      gtcttctacttctgag--gagcaggtagcccgggacaccgaggaggttttccgcagctat
F6PMP8_BAK1-02      gtcttctacttctgag--gagcaggtagcccgggacaccgaggaggttttccgcagctat
Q52HB2_BAK1-01      gtcttctacttctgag--gagcaggtagcccgggacaccgaggaggttttccgcagctat
F1PAN9_BAX-01       gcccaccagctctgagcagatcatgaagacaggggccct-------tttgcttcag----
Q8HYU5_BAX-01       gcccaccagctctgagcagatcatgaagacaggggccct-------tttgcttcag----
                    * *  * *  ******  ** ** * ** * *** * *        *** *  ***    

F6PMP8_BAK1-03      gttttttaccgccatcggcaggagcaggaggctgagggggcggctgtgccagctgaccca
F6PMP8_BAK1-01      gttttttaccgccatcggcaggagcaggaggctgagggggcggctgtgccagctgaccca
F6PMP8_BAK1-02      gttttttaccgccatcggcag---------------------------------------
Q52HB2_BAK1-01      gttttttaccgccatcggcaggagcaggaggctgagggggcggctgtgccagctgaccca
F1PAN9_BAX-01       ggtttcatccaagatcgagcagggcgaatggggggagagacacctg----agctgccctt
Q8HYU5_BAX-01       ggtttcatccaagatcgagcagggcgaatggggggagagacacctg----agctgccctt
                    * ***   **   ****                                           

F6PMP8_BAK1-03      gaaatggtcaccttgcccctagaacctagcagcaccatggggcaggtgggtcggcagctc
F6PMP8_BAK1-01      gaaatggtcaccttgcccctagaacctagcagcaccatggggcaggtgggtcggcagctc
F6PMP8_BAK1-02      ---------------------gaacctagcagcaccatggggcaggtgggtcggcagctc
Q52HB2_BAK1-01      gaaatggtcaccttgcccctagaacctagcagcaccatggggcaggtgggtcggcagctc
F1PAN9_BAX-01       ggagcaggtg------ccccaggatgcatc--caccaagaagc---tgagcgaatgtctc
Q8HYU5_BAX-01       ggagcaggtg------ccccaggatgcatc--caccaagaagc---tgagcgaatgtctc
                                         * *   * *  ***** *  **   ** *       ***

F6PMP8_BAK1-03      gctatcattggggacgacatcaaccagcgctatgactcggagttccaggccatgct-gca
F6PMP8_BAK1-01      gctatcattggggacgacatcaaccagcgctatgactcggagttccaggccatgct-gca
F6PMP8_BAK1-02      gctatcattggggacgacatcaaccagcgctatgactcggagttccaggccatgct-gca
Q52HB2_BAK1-01      gctatcattggggacgacatcaaccagcgctatgactcggagttccaggccatgct-gca
F1PAN9_BAX-01       aagcgcatcggagatg------aactggacagtaacatggagttgcagaggatgatcgca
Q8HYU5_BAX-01       aagcgcatcggagatg------aactggacagtaacatggagttgcagaggatgatcgca
                         *** ** ** *      * * *  *  * **  ****** ***   *** * ***

F6PMP8_BAK1-03      gcacctacagccgacagcagagaatgcctatgagtacttcaccaagattgcctcgaggcc
F6PMP8_BAK1-01      gcacctacagccgacagcagagaatgcctatgagtacttcaccaagattgcctcg-----
F6PMP8_BAK1-02      gcacctacagccgacagcagagaatgcctatgagtacttcaccaagattgcctcg-----
Q52HB2_BAK1-01      gcacctacagccgacagcagagaatgcctatgagtacttcaccaagattgcctcg-----
F1PAN9_BAX-01       g------ctgtggaca-cagactctccccgtgaggtcttcttccgagtggcagctgag--
Q8HYU5_BAX-01       g------ctgtggaca-cagactctccccgtgaggtcttcttccgagtggcagctgag--
                    *      * *  **** ****   * **  ****  ****  *    * **  *      

F6PMP8_BAK1-03      agcagcaacacccacagcctatttgagagcggcatcaactggggccgagtggtggctctc
F6PMP8_BAK1-01      ---------------agcctatttgagagcggcatcaactggggccgagtggtggctctc
F6PMP8_BAK1-02      ---------------agcctatttgagagcggcatcaactggggccgagtggtggctctc
Q52HB2_BAK1-01      ---------------agcctatttgagagcggcatcaactggggccgagtggtggctctc
F1PAN9_BAX-01       ---------------atgttttctgatggcaacttcaactggggccgggttgttgccctc
Q8HYU5_BAX-01       ---------------atgttttctgatggcaacttcaactggggccgggttgttgccctc
                                   *   * * ***  **  * ************* ** ** ** ***

F6PMP8_BAK1-03      ctgggctttggctaccgcctggccct-----gcatgtctaccaa----cgcggcctga--
F6PMP8_BAK1-01      ctgggctttggctaccgcctggccct-----gcatgtctaccaa----cgcggcctgacc
F6PMP8_BAK1-02      ctgggctttggctaccgcctggccct-----gcatgtctaccaa----cgcggcctgacc
Q52HB2_BAK1-01      ctgggctttggctaccgcctggccct-----gcatgtctaccaa----cgcggcctgacc
F1PAN9_BAX-01       ttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgagctgatc
Q8HYU5_BAX-01       ttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgagctgatc
                     *   ***** *  *   ****  **      * *** ******    * **  ****  

F6PMP8_BAK1-03      ------------------------------------------------------------
F6PMP8_BAK1-01      gg---cttcctgggccaggt----gacccgcttcgtggccgacttcatgctgcatcattg
F6PMP8_BAK1-02      gg---cttcctgggccaggt----gacccgcttcgtggccgacttcatgctgcatcattg
Q52HB2_BAK1-01      gg---cttcctgggccaggt----gacccgcttcgtggccgacttcatgctgcatcattg
F1PAN9_BAX-01       aggaccatcatgggctggacactggacttccttcgagagcggctgctgg-----------
Q8HYU5_BAX-01       aggaccatcatgggctggacactggacttccttcgagagcggctgctgg-----------
                                                                                

F6PMP8_BAK1-03      ------------------------------------------------------------
F6PMP8_BAK1-01      cattgcccggtggatcgcgcagaggggtggctgggtggcagccctgaacttgggaaacgg
F6PMP8_BAK1-02      cattgcccggtggatcgcgcagaggggtggctgggtggcagccctgaacttgggaaacgg
Q52HB2_BAK1-01      cattgcccggtggatcgcgcagaggggtggctgggtggcagccctgaacttgggaaacgg
F1PAN9_BAX-01       --------gctggatccaggaccagggtggttgggtg---agcctgcagtcc--------
Q8HYU5_BAX-01       --------gctggatccaggaccagggtggttgggac---ggcctcctctcctactttgg
                                                                                

F6PMP8_BAK1-03      ------------------------------------------------------------
F6PMP8_BAK1-01      ccccatcctgaacgtgctgatagtgctgtctgtgg-------ttctgttgggccagtttg
F6PMP8_BAK1-02      ccccatcctgaacgtgctgatagtgctgtctgtgg-------ttctgttgggccagtttg
Q52HB2_BAK1-01      ccccatcctgaacgtgctgatagtgctgtctgtgg-------ttctgttgggccagtttg
F1PAN9_BAX-01       --------cgaaggagccgaagaccacttgtttgg-----aagcctacagggttgt----
Q8HYU5_BAX-01       gacacccacgtggcagacagtgaccatctttgtggctggagtgcttactgcgtcactcac
                                                                                

F6PMP8_BAK1-03      ------------------------------------------------------------
F6PMP8_BAK1-01      tgcctacaggtctgggggaaaggagagagaagttcatgattaagccaaatgcagggagcg
F6PMP8_BAK1-02      tg---------------------------------------------------------g
Q52HB2_BAK1-01      tg---------------------------------------------------------g
F1PAN9_BAX-01       --gtt------------------------------------------------------g
Q8HYU5_BAX-01       catct------------------------------------------------------g
                                                                                

F6PMP8_BAK1-03      ------------------------------------------------------------
F6PMP8_BAK1-01      gatgcagatggagcccgctgaccagcccccaccctctgagtgtgtctgaaaataaactgt
F6PMP8_BAK1-02      tacgaagat----------------------tcttc-----------------aaatcat
Q52HB2_BAK1-01      tacgaagat----------------------tcttc-----------------aaatcat
F1PAN9_BAX-01       gaggtag-----------------------------------------------------
Q8HYU5_BAX-01       gaaaaagatgggctga--------------------------------------------
                                                                                

F6PMP8_BAK1-03      --
F6PMP8_BAK1-01      aa
F6PMP8_BAK1-02      ga
Q52HB2_BAK1-01      ga
F1PAN9_BAX-01       --
Q8HYU5_BAX-01       --
                      

© 1998-2020Legal notice