Dataset for CDS BAX-like of Organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

19 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0N8K9_BAX-03       atgagccaccctagtt-----------------cgctgggtcc-cctagg
A0A8C0N8K9_BAX-01       atggac-------------------------------gggtccggggagc
A0A8I3MD65_BAX-01       atggac-------------------------------gggtccggggagc
A0A8C0N8K9_BAX-02       atggac-------------------------------gggtccggggagc
A0A8I3MD65_BAX-02       atggac-------------------------------gggtccggggagc
A0A8C0MVC8_BAK1-01      atggcatccg-----------------------ggcaaggcccaggg---
A0A8I3PJD5_BAK1-01      atggcatccg-----------------------ggcaaggcccaggg---
A0A8C0MVC8_BAK1-02      atggcatccg-----------------------ggcaaggcccaggg---
A0A8C0MVC8_BAK1-03      atggcatccg-----------------------ggcaaggcccaggg---
A0A8I3PJD5_BAK1-02      atggcatccg-----------------------ggcaaggcccaggg---
Q52HB2_BAK1-01          atggcatccg-----------------------ggcaaggcccaggg---
A0A8I3PNV3_BOK-02       atgagcgcagcgagctgcgggccggcgccaggcggcaacgcccgggg---
A0A8C0PFA3_BOK-02       atgagcgcagcgagctgcgggccggcgccaggcggcaacgcccgggg---
A0A8I3S7I1_BOK-02       atgagcgcagcgagctgcgggccggcgccaggcggcaacgcccgggg---
A0A8C0PFA3_BOK-01       atgagcgcagcgagctgcgggccggcgccaggcggcaacgcccgggg---
A0A8I3PNV3_BOK-01       atgagcgcagcgagctgcgggccggcgccaggcggcaacgcccgggg---
A0A8I3S7I1_BOK-01       atgagcgcagcgagctgcgggccggcgccaggcggcaacgcccgggg---
A0A8I3PNV3_BOK-03       atgccccc---------------------------ctgcgcccgcag---
A0A8I3S7I1_BOK-03       atgccccc---------------------------ctgcgcccgcgg---
                        ***                                    * **       

A0A8C0N8K9_BAX-03       acccaagagtccaggcacctcttccctcctttctcctctagggcccacca
A0A8C0N8K9_BAX-01       aacccagaggcggg--------------------------gggcccacca
A0A8I3MD65_BAX-01       aacccagaggcggg--------------------------gggcccacca
A0A8C0N8K9_BAX-02       aacccagaggcggg--------------------------gggcccacca
A0A8I3MD65_BAX-02       aacccagaggcggg--------------------------gggcccacca
A0A8C0MVC8_BAK1-01      -cctcccaggcggg------------------agtgtggagaggctgccc
A0A8I3PJD5_BAK1-01      -cctcccaggcggg------------------agtgtggagaggctgccc
A0A8C0MVC8_BAK1-02      -cctcccaggcggg------------------agtgtggagaggctgccc
A0A8C0MVC8_BAK1-03      -cctcccaggcggg------------------agtgtggagaggctgccc
A0A8I3PJD5_BAK1-02      -cctcccaggcggg------------------agtgtggagaggctgccc
Q52HB2_BAK1-01          -cctcccaggcggg------------------agtgtggagaggctgccc
A0A8I3PNV3_BOK-02       -tcgcggggacggc------------------ggcggccggtggcctccg
A0A8C0PFA3_BOK-02       -tcgcggggacggc------------------ggcggccggtggcctccg
A0A8I3S7I1_BOK-02       -tcgcggggacggc------------------ggcggccggtggcctccg
A0A8C0PFA3_BOK-01       -tcgcggggacggc------------------ggcggccggtggcctccg
A0A8I3PNV3_BOK-01       -tcgcggggacggc------------------ggcggccggtggcctccg
A0A8I3S7I1_BOK-01       -tcgcggggacggc------------------ggcggccggtggcctccg
A0A8I3PNV3_BOK-03       -cc-------------------------------tggccggtctgctccg
A0A8I3S7I1_BOK-03       -cc-------------------------------tggccggtctgctccg
                          *                                     *      ** 

A0A8C0N8K9_BAX-03       gctctga---------------------------gcagatcatgaagac-
A0A8C0N8K9_BAX-01       gctctga---------------------------gcagatcatgaagac-
A0A8I3MD65_BAX-01       gctctga---------------------------gcagatcatgaagac-
A0A8C0N8K9_BAX-02       gctctga---------------------------gcagatcatgaagac-
A0A8I3MD65_BAX-02       gctctga---------------------------gcagatcatgaagac-
A0A8C0MVC8_BAK1-01      cgtcttc--------------------tacttctgaggagcaggta----
A0A8I3PJD5_BAK1-01      cgtcttc--------------------tacttctgaggagcaggta----
A0A8C0MVC8_BAK1-02      cgtcttc--------------------tacttctgaggagcaggta----
A0A8C0MVC8_BAK1-03      cgtcttc--------------------tacttctgaggagcaggta----
A0A8I3PJD5_BAK1-02      cgtcttc--------------------tacttctgaggagcaggta----
Q52HB2_BAK1-01          cgtcttc--------------------tacttctgaggagcaggta----
A0A8I3PNV3_BOK-02       gagctgcgccgggaactcgctcgggcctccttaagcggggcggggaggcg
A0A8C0PFA3_BOK-02       gagctgcgccgggaactcgctcgggcctccttaagcggggcggggaggcg
A0A8I3S7I1_BOK-02       gagctgcgccgggaactcgctcgggcctccttaagcggggcggggaggcg
A0A8C0PFA3_BOK-01       gagctgcgccgggaactcgctcgggcctccttaagcggggcggggaggcg
A0A8I3PNV3_BOK-01       gagctgcgccgggaactcgctcgggcctccttaagcggggcggggaggcg
A0A8I3S7I1_BOK-01       gagctgcgccgggaactcgctcgggcctccttaagcggggcggggaggcg
A0A8I3PNV3_BOK-03       catccac------------cccgggctgcct---gcgtggca--------
A0A8I3S7I1_BOK-03       cgtccac------------cccgggctgcct---gcgtggca--------
                           *                              *     *         

A0A8C0N8K9_BAX-03       --------------------------------------------------
A0A8C0N8K9_BAX-01       --------------------------------------------------
A0A8I3MD65_BAX-01       --------------------------------------------------
A0A8C0N8K9_BAX-02       --------------------------------------------------
A0A8I3MD65_BAX-02       --------------------------------------------------
A0A8C0MVC8_BAK1-01      -----------------------gcccgggacaccga-------------
A0A8I3PJD5_BAK1-01      -----------------------gcccgggacaccga-------------
A0A8C0MVC8_BAK1-02      -----------------------gcccgggacaccga-------------
A0A8C0MVC8_BAK1-03      -----------------------gcccgggacaccga-------------
A0A8I3PJD5_BAK1-02      -----------------------gcccgggacaccga-------------
Q52HB2_BAK1-01          -----------------------gcccgggacaccga-------------
A0A8I3PNV3_BOK-02       gcgggaagctcggccgcggctccgccccgggggctgccttttccttagaa
A0A8C0PFA3_BOK-02       gcgggaagctcggccgcggctccgccccgggggctgccttttccttagaa
A0A8I3S7I1_BOK-02       gcgggaagctcggccgcggctccgccccgggggctgccttttccttagaa
A0A8C0PFA3_BOK-01       gcgggaagctcggccgcggctccgccccgggggctgccttttccttagaa
A0A8I3PNV3_BOK-01       gcgggaagctcggccgcggctccgccccgggggctgccttttccttagaa
A0A8I3S7I1_BOK-01       gcgggaagctcggccgcggctccgccccgggggctgccttttccttagaa
A0A8I3PNV3_BOK-03       --------------tgcggcccggcccgtgatggcac-------------
A0A8I3S7I1_BOK-03       --------------tgcggcccggcccgtgatggcac-------------
                                                                          

A0A8C0N8K9_BAX-03       --aggggccc---------------------------------ttttgct
A0A8C0N8K9_BAX-01       --aggggccc---------------------------------ttttgct
A0A8I3MD65_BAX-01       --aggggccc---------------------------------ttttgct
A0A8C0N8K9_BAX-02       --aggggccc---------------------------------ttttgct
A0A8I3MD65_BAX-02       --aggggccc---------------------------------ttttgct
A0A8C0MVC8_BAK1-01      --ggaggttt----------------tccgcag----------ctatgtt
A0A8I3PJD5_BAK1-01      --ggaggttt----------------tccgcag----------ctatgtt
A0A8C0MVC8_BAK1-02      --ggaggttt----------------tccgcag----------ctatgtt
A0A8C0MVC8_BAK1-03      --ggaggttt----------------tccgcag----------ctatgtt
A0A8I3PJD5_BAK1-02      --ggaggttt----------------tccgcag----------ctatgtt
Q52HB2_BAK1-01          --ggaggttt----------------tccgcag----------ctatgtt
A0A8I3PNV3_BOK-02       ggcgaagccccaagcctcgcctcccgcccgcggagcccgcgccccgcgcc
A0A8C0PFA3_BOK-02       ggcgaagccccaagcctcgcctcccgcccgcggagcccgcgccccgcgcc
A0A8I3S7I1_BOK-02       ggcgaagccccaagcctcgcctcccgcccgcggagcccgcgccccgcgcc
A0A8C0PFA3_BOK-01       ggcgaagccccaagcctcgcctcccgcccgcggagcccgcgccccgcgcc
A0A8I3PNV3_BOK-01       ggcgaagccccaagcctcgcctcccgcccgcggagcccgcgccccgcgcc
A0A8I3S7I1_BOK-01       ggcgaagccccaagcctcgcctcccgcccgcggagcccgcgccccgcgcc
A0A8I3PNV3_BOK-03       --agacgccctcatcggccccgccggtccacggcgcttccgtt---tgct
A0A8I3S7I1_BOK-03       --agacgccctcatcggccccgccggtccacggcgcttccgtt---tgct
                           *  *                                        *  

A0A8C0N8K9_BAX-03       tcagggtttcatccaagatcgagcagggcgaatggg--------------
A0A8C0N8K9_BAX-01       tcagggtttcatccaagatcgagcagggcgaatggg--------------
A0A8I3MD65_BAX-01       tcagggtttcatccaagatcgagcagggcgaatggg--------------
A0A8C0N8K9_BAX-02       tcagg---------------------------------------------
A0A8I3MD65_BAX-02       tcagg---------------------------------------------
A0A8C0MVC8_BAK1-01      ttttaccgccatcggcag--gagcaggaggctgagg--------------
A0A8I3PJD5_BAK1-01      ttttaccgccatcggcag--gagcaggaggctgagg--------------
A0A8C0MVC8_BAK1-02      ttttaccgccatcggcag--gagcaggaggctgagg--------------
A0A8C0MVC8_BAK1-03      ttttaccgccatcggcag--------------------------------
A0A8I3PJD5_BAK1-02      ttttaccgccatcggcag--gagcaggaggctgagg--------------
Q52HB2_BAK1-01          ttttaccgccatcggcag--gagcaggaggctgagg--------------
A0A8I3PNV3_BOK-02       ccgcgcccctcgccgccg--ccccagggcgcacaggccggcgcactccgc
A0A8C0PFA3_BOK-02       ccgcgcccctcgccgccg--ccccagggcgcacaggccggcgcactccgc
A0A8I3S7I1_BOK-02       ccgcgcccctcgccgccg--ccccagggcgcacaggccggcgcactccgc
A0A8C0PFA3_BOK-01       ccgcgcccctcgccgccg--ccccagggcgcacaggccggcgcactccgc
A0A8I3PNV3_BOK-01       ccgcgcccctcgccgccg--ccccagggcgcacaggccggcgcactccgc
A0A8I3S7I1_BOK-01       ccgcgcccctcgccgccg--ccccagggcgcacaggccggcgcactccgc
A0A8I3PNV3_BOK-03       tggctgcaccagcggcgg--cgcccgggcgcgtgga-------attcctt
A0A8I3S7I1_BOK-03       tggctgcaccagcggcgg--cgcccaggcgcgtgga-------attcctt
                                                                          

A0A8C0N8K9_BAX-03       --------------------------------------------------
A0A8C0N8K9_BAX-01       --------------------------------------------------
A0A8I3MD65_BAX-01       --------------------------------------------------
A0A8C0N8K9_BAX-02       --------------------------------------------------
A0A8I3MD65_BAX-02       --------------------------------------------------
A0A8C0MVC8_BAK1-01      ---------------------------gggcgg-----------------
A0A8I3PJD5_BAK1-01      ---------------------------gggcgg-----------------
A0A8C0MVC8_BAK1-02      ---------------------------gggcgg-----------------
A0A8C0MVC8_BAK1-03      --------------------------------------------------
A0A8I3PJD5_BAK1-02      ---------------------------gggcgg-----------------
Q52HB2_BAK1-01          ---------------------------gggcgg-----------------
A0A8I3PNV3_BOK-02       ggggccccgggcgcacgggctggcgacgggcggg---------cgcgtcc
A0A8C0PFA3_BOK-02       ggggccccgggcgcacgggctggcgacgggcggg---------cgcgtcc
A0A8I3S7I1_BOK-02       ggggccccgggcgcacgggctggcgacgggcggg---------cgcgtcc
A0A8C0PFA3_BOK-01       ggggccccgggcgcacgggctggcgacgggcggg---------cgcgtcc
A0A8I3PNV3_BOK-01       ggggccccgggcgcacgggctggcgacgggcggg---------cgcgtcc
A0A8I3S7I1_BOK-01       ggggccccgggcgcacgggctggcgacgggcggg---------cgcgtcc
A0A8I3PNV3_BOK-03       gg-------------cgagtgggcagcgggcagggccgcgacacacgccc
A0A8I3S7I1_BOK-03       gg-------------cgagtgggcagcgggcagggccgtgacacacgccc
                                                                          

A0A8C0N8K9_BAX-03       --------------------------------------------------
A0A8C0N8K9_BAX-01       --------------------------------------------------
A0A8I3MD65_BAX-01       --------------------------------------------------
A0A8C0N8K9_BAX-02       --------------------------------------------------
A0A8I3MD65_BAX-02       --------------------------------------------------
A0A8C0MVC8_BAK1-01      --------------------------------------------ctgtgc
A0A8I3PJD5_BAK1-01      --------------------------------------------ctgtgc
A0A8C0MVC8_BAK1-02      --------------------------------------------ctgtgc
A0A8C0MVC8_BAK1-03      --------------------------------------------------
A0A8I3PJD5_BAK1-02      --------------------------------------------ctgtgc
Q52HB2_BAK1-01          --------------------------------------------ctgtgc
A0A8I3PNV3_BOK-02       tcatcgctcgggacggacacccgaggccagcgcccctcccggccccgcgc
A0A8C0PFA3_BOK-02       tcatcgctcgggacggacacccgaggccagcgcccctcccggccccgcgc
A0A8I3S7I1_BOK-02       tcatcgctcgggacggacacccgaggccagcgcccctcccggccccgcgc
A0A8C0PFA3_BOK-01       tcatcgctcgggacggacacccgaggccagcgcccctcccggccccgcgc
A0A8I3PNV3_BOK-01       tcatcgctcgggacggacacccgaggccagcgcccctcccggccccgcgc
A0A8I3S7I1_BOK-01       tcatcgctcgggacggacacccgaggccagcgcccctcccggccccgcgc
A0A8I3PNV3_BOK-03       acgcggctcggggag----cccgggtctgg-------------gcggcgc
A0A8I3S7I1_BOK-03       acgcggctcggggag----cccgggtctgg-------------gcggcgc
                                                                          

A0A8C0N8K9_BAX-03       --------------gggagagacacctgagctgcccttggagcaggtgcc
A0A8C0N8K9_BAX-01       --------------gggagagacacctgagctgcccttggagcaggtgcc
A0A8I3MD65_BAX-01       --------------gggagagacacctgagctgcccttggagcaggtgcc
A0A8C0N8K9_BAX-02       --------------------------------------------------
A0A8I3MD65_BAX-02       --------------------------------------------------
A0A8C0MVC8_BAK1-01      cagctg---acccagaaatggtcacct----tgcccctagaaccta----
A0A8I3PJD5_BAK1-01      cagctg---acccagaaatggtcacct----tgcccctagaaccta----
A0A8C0MVC8_BAK1-02      cagctg---acccagaaatggtcacct----tgcccctagaaccta----
A0A8C0MVC8_BAK1-03      ---------------------------------------gaaccta----
A0A8I3PJD5_BAK1-02      cagctg---acccagaaatggtcacct----tgcccctagaaccta----
Q52HB2_BAK1-01          cagctg---acccagaaatggtcacct----tgcccctagaaccta----
A0A8I3PNV3_BOK-02       ccgcgaaatgccgcggcagaggtgccg----cgcccctggcccgcgtccc
A0A8C0PFA3_BOK-02       ccgcgaaatgccgcggcagaggtgccg----cgcccctggcccgcgtccc
A0A8I3S7I1_BOK-02       ccgcgaaatgccgcggcagaggtgccg----cgcccctggcccgcgtccc
A0A8C0PFA3_BOK-01       ccgcgaaatgccgcggcagaggtgccg----cgcccctggcccgcgtccc
A0A8I3PNV3_BOK-01       ccgcgaaatgccgcggcagaggtgccg----cgcccctggcccgcgtccc
A0A8I3S7I1_BOK-01       ccgcgaaatgccgcggcagaggtgccg----cgcccctggcccgcgtccc
A0A8I3PNV3_BOK-03       ctggg----gccccgggcgaggc-ctt----cactcctgggtcgca----
A0A8I3S7I1_BOK-03       ctggg----gccccgggcgaggc-ctt----cgctcctgggtcgca----
                                                                          

A0A8C0N8K9_BAX-03       ---------------------------------------------ccagg
A0A8C0N8K9_BAX-01       ---------------------------------------------ccagg
A0A8I3MD65_BAX-01       ---------------------------------------------ccagg
A0A8C0N8K9_BAX-02       --------------------------------------------------
A0A8I3MD65_BAX-02       --------------------------------------------------
A0A8C0MVC8_BAK1-01      ---------------gcagcac-----------------------catgg
A0A8I3PJD5_BAK1-01      ---------------gcagcac-----------------------catgg
A0A8C0MVC8_BAK1-02      ---------------gcagcac-----------------------catgg
A0A8C0MVC8_BAK1-03      ---------------gcagcac-----------------------catgg
A0A8I3PJD5_BAK1-02      ---------------gcagcac-----------------------catgg
Q52HB2_BAK1-01          ---------------gcagcac-----------------------catgg
A0A8I3PNV3_BOK-02       cgccatggaggtgctgcggcgctcctcggtcctcgccgcggagatcatgg
A0A8C0PFA3_BOK-02       cgccatggaggtgctgcggcgctcctcggtcctcgccgcggagatcatgg
A0A8I3S7I1_BOK-02       cgccatggaggtgctgcggcgctcctcggtcctcgccgcggagatcatgg
A0A8C0PFA3_BOK-01       cgccatggaggtgctgcggcgctcctcggtcctcgccgcggagatcatgg
A0A8I3PNV3_BOK-01       cgccatggaggtgctgcggcgctcctcggtcctcgccgcggagatcatgg
A0A8I3S7I1_BOK-01       cgccatggaggtgctgcggcgctcctcggtcctcgccgcggagatcatgg
A0A8I3PNV3_BOK-03       ---------------gcggtgc-------------ccgcgcccagcaagg
A0A8I3S7I1_BOK-03       ---------------gcggtgc-------------ccgcacccagcaagg
                                                                          

A0A8C0N8K9_BAX-03       atgcatccacca------------------------------------ag
A0A8C0N8K9_BAX-01       atgcatccacca------------------------------------ag
A0A8I3MD65_BAX-01       atgcatccacca------------------------------------ag
A0A8C0N8K9_BAX-02       --------------------------------------------------
A0A8I3MD65_BAX-02       --------------------------------------------------
A0A8C0MVC8_BAK1-01      ------------------------------------------------gg
A0A8I3PJD5_BAK1-01      ------------------------------------------------gg
A0A8C0MVC8_BAK1-02      ------------------------------------------------gg
A0A8C0MVC8_BAK1-03      ------------------------------------------------gg
A0A8I3PJD5_BAK1-02      ------------------------------------------------gg
Q52HB2_BAK1-01          ------------------------------------------------gg
A0A8I3PNV3_BOK-02       acgcctttgaccgctcgcccagcgacaaggagctggtggcccaggccaag
A0A8C0PFA3_BOK-02       acgcctttgaccgctcgcccagcgacaaggagctggtggcccaggccaag
A0A8I3S7I1_BOK-02       acgcctttgaccgctcgcccagcgacaaggagctggtggcccaggccaag
A0A8C0PFA3_BOK-01       acgcctttgaccgctcgcccagcgacaaggagctggtggcccaggccaag
A0A8I3PNV3_BOK-01       acgcctttgaccgctcgcccagcgacaaggagctggtggcccaggccaag
A0A8I3S7I1_BOK-01       acgcctttgaccgctcgcccagcgacaaggagctggtggcccaggccaag
A0A8I3PNV3_BOK-03       acgccccccaaggcagccccacctgcgtgg------------------gg
A0A8I3S7I1_BOK-03       acgccccccaaggcagccccacctgcgtgg------------------gg
                                                                          

A0A8C0N8K9_BAX-03       aagctgagcgaatgtctcaagcgca--------------------tcgga
A0A8C0N8K9_BAX-01       aagctgagcgaatgtctcaagcgca--------------------tcgga
A0A8I3MD65_BAX-01       aagctgagcgaatgtctcaagcgca--------------------tcgga
A0A8C0N8K9_BAX-02       --------------------------------------------------
A0A8I3MD65_BAX-02       --------------------------------------------------
A0A8C0MVC8_BAK1-01      caggtgggtcggcagctcgctatca--------------------ttggg
A0A8I3PJD5_BAK1-01      caggtgggtcggcagctcgctatca--------------------ttggg
A0A8C0MVC8_BAK1-02      caggtgggtcggcagctcgctatca--------------------ttggg
A0A8C0MVC8_BAK1-03      caggtgggtcggcagctcgctatca--------------------ttggg
A0A8I3PJD5_BAK1-02      caggtgggtcggcagctcgctatca--------------------ttggg
Q52HB2_BAK1-01          caggtgggtcggcagctcgctatca--------------------ttggg
A0A8I3PNV3_BOK-02       gcgctgggccgggagttcgtgcacgcgcggctgctgcgcgccggcctggc
A0A8C0PFA3_BOK-02       gcgctgggccgggagttcgtgcacgcgcggctgctgcgcgccggcctggc
A0A8I3S7I1_BOK-02       gcgctgggccgggagttcgtgcacgcgcggctgctgcgcgccggcctggc
A0A8C0PFA3_BOK-01       gcgctgggccgggagttcgtgcacgcgcggctgctgcgcgccggcctggc
A0A8I3PNV3_BOK-01       gcgctgggccgggagttcgtgcacgcgcggctgctgcgcgccggcctggc
A0A8I3S7I1_BOK-01       gcgctgggccgggagttcgtgcacgcgcggctgctgcgcgccggcctggc
A0A8I3PNV3_BOK-03       gcgctggcacg---gcccctgcccgcgtggc-------------cctggc
A0A8I3S7I1_BOK-03       gcgctggcacg---gcccctgcccgcgtggc-------------cctggc
                                                                          

A0A8C0N8K9_BAX-03       gatgaactggacag------------------------------------
A0A8C0N8K9_BAX-01       gatgaactggacag------------------------------------
A0A8I3MD65_BAX-01       gatgaactggacag------------------------------------
A0A8C0N8K9_BAX-02       --------------------------------------------------
A0A8I3MD65_BAX-02       --------------------------------------------------
A0A8C0MVC8_BAK1-01      gacgacatcaacca------------------------------------
A0A8I3PJD5_BAK1-01      gacgacatcaacca------------------------------------
A0A8C0MVC8_BAK1-02      gacgacatcaacca------------------------------------
A0A8C0MVC8_BAK1-03      gacgacatcaacca------------------------------------
A0A8I3PJD5_BAK1-02      gacgacatcaacca------------------------------------
Q52HB2_BAK1-01          gacgacatcaacca------------------------------------
A0A8I3PNV3_BOK-02       ctggaccgcgcccgagcgcgccgctcccgcccccgggggccgcctggccg
A0A8C0PFA3_BOK-02       ctggaccgcgcccgagcgcgccgctcccgcccccgggggccgcctggccg
A0A8I3S7I1_BOK-02       ctggaccgcgcccgagcgcgccgctcccgcccccgggggccgcctggccg
A0A8C0PFA3_BOK-01       ctggaccgcgcccgagcgcgccgctcccgcccccgggggccgcctggccg
A0A8I3PNV3_BOK-01       ctggaccgcgcccgagcgcgccgctcccgcccccgggggccgcctggccg
A0A8I3S7I1_BOK-01       ctggaccgcgcccgagcgcgccgctcccgcccccgggggccgcctggccg
A0A8I3PNV3_BOK-03       tgctgccccgcccg-----------cctgcccc-----------------
A0A8I3S7I1_BOK-03       tgctgccccacccg-----------cctgcccc-----------------
                                                                          

A0A8C0N8K9_BAX-03       -------------------------------taacatggagttgcagagg
A0A8C0N8K9_BAX-01       -------------------------------taacatggagttgcagagg
A0A8I3MD65_BAX-01       -------------------------------taacatggagttgcagagg
A0A8C0N8K9_BAX-02       ------------------------------------------------gg
A0A8I3MD65_BAX-02       ------------------------------------------------gg
A0A8C0MVC8_BAK1-01      ------gcgct-------------------atgactcggagtt--ccagg
A0A8I3PJD5_BAK1-01      ------gcgct-------------------atgactcggagtt--ccagg
A0A8C0MVC8_BAK1-02      ------gcgct-------------------atgactcggagtt--ccagg
A0A8C0MVC8_BAK1-03      ------gcgct-------------------atgactcggagtt--ccagg
A0A8I3PJD5_BAK1-02      ------gcgct-------------------atgactcggagtt--ccagg
Q52HB2_BAK1-01          ------gcgct-------------------atgactcggagtt--ccagg
A0A8I3PNV3_BOK-02       aggtgtgcgcggtgctgctgcgcctgggggatgagctggagctgatccgg
A0A8C0PFA3_BOK-02       aggtgtgcgcggtgctgctgcgcctgggggatgagctggagctgatccgg
A0A8I3S7I1_BOK-02       aggtgtgcgcggtgctgctgcgcctgggggatgagctggagctgatccgg
A0A8C0PFA3_BOK-01       aggtgtgcgcggtgctgctgcgcctgggggatgagctggagctgatccgg
A0A8I3PNV3_BOK-01       aggtgtgcgcggtgctgctgcgcctgggggatgagctggagctgatccgg
A0A8I3S7I1_BOK-01       aggtgtgcgcggtgctgctgcgcctgggggatgagctggagctgatccgg
A0A8I3PNV3_BOK-03       ----gagcgctcagcggct--------gggatgagctggagctgatccgg
A0A8I3S7I1_BOK-03       ----gagcgctcagcggct--------gggatgagctggagctgatccgg
                                                                        **

A0A8C0N8K9_BAX-03       at----------gatcgcagc---------tgtggacacagactctcc--
A0A8C0N8K9_BAX-01       at----------gatcgcagc---------tgtggacacagactctcc--
A0A8I3MD65_BAX-01       at----------gatcgcagc---------tgtggacacagactctcc--
A0A8C0N8K9_BAX-02       at----------gatcgcagc---------tgtggacacagactctcc--
A0A8I3MD65_BAX-02       at----------gatcgcagc---------tgtggacacagactctcc--
A0A8C0MVC8_BAK1-01      ccatgctgcagcacctacagc---------cgacagcagagaat------
A0A8I3PJD5_BAK1-01      ccatgctgcagcacctacagc---------cgacagcagagaat------
A0A8C0MVC8_BAK1-02      ccatgctgcagcacctacagc---------cgacagcagagaat------
A0A8C0MVC8_BAK1-03      ccatgctgcagcacctacagc---------cgacagcagagaat------
A0A8I3PJD5_BAK1-02      ccatgctgcagcacctacagc---------cgacagcagagaat------
Q52HB2_BAK1-01          ccatgctgcagcacctacagc---------cgacagcagagaat------
A0A8I3PNV3_BOK-02       cc------cagcgtctaccgcaacgtggcgcgccagctgaacatctccct
A0A8C0PFA3_BOK-02       cc------cagcgtctaccgcaacgtggcgcgccagctgaacatctccct
A0A8I3S7I1_BOK-02       cc------cagcgtctaccgcaacgtggcgcgccagctgaacatctccct
A0A8C0PFA3_BOK-01       cc------cagcgtctaccgcaacgtggcgcgccagctgaacatctccct
A0A8I3PNV3_BOK-01       cc------cagcgtctaccgcaacgtggcgcgccagctgaacatctccct
A0A8I3S7I1_BOK-01       cc------cagcgtctaccgcaacgtggcgcgccagctgaacatctccct
A0A8I3PNV3_BOK-03       cc------cagcgtctaccgcaacgtggcgcgccagctgaacatctccct
A0A8I3S7I1_BOK-03       cc------cagcgtctaccgcaacgtggcgcgccagctgaacatctccct
                                         * **          *    *  *   *      

A0A8C0N8K9_BAX-03       -----ccgtgag-------------gtcttcttccgagtggcagct----
A0A8C0N8K9_BAX-01       -----ccgtgag-------------gtcttcttccgagtggcagct----
A0A8I3MD65_BAX-01       -----ccgtgag-------------gtcttcttccgagtggcagct----
A0A8C0N8K9_BAX-02       -----ccgtgag-------------gtcttcttccgagtggcagct----
A0A8I3MD65_BAX-02       -----ccgtgag-------------gtcttcttccgagtggcagct----
A0A8C0MVC8_BAK1-01      ---gcctatgagta-------------cttcaccaagattgcctcg----
A0A8I3PJD5_BAK1-01      ---gcctatgagta-------------cttcaccaagattgcctcg----
A0A8C0MVC8_BAK1-02      ---gcctatgagta-------------cttcaccaagattgcctcgaggc
A0A8C0MVC8_BAK1-03      ---gcctatgagta-------------cttcaccaagattgcctcg----
A0A8I3PJD5_BAK1-02      ---gcctatgagta-------------cttcaccaagattgcctcg----
Q52HB2_BAK1-01          ---gcctatgagta-------------cttcaccaagattgcctcg----
A0A8I3PNV3_BOK-02       gcagtccgagagcgtggtgactgacgccttcctggcggtggcatct----
A0A8C0PFA3_BOK-02       gcagtccgagagcgtggtgactgacgccttcctggcggtggcatct----
A0A8I3S7I1_BOK-02       gcagtccgagagcgtggtgactgacgccttcctggcggtggcatct----
A0A8C0PFA3_BOK-01       gcagtccgagagcgtggtgactgacgccttcctggcggtggcatct----
A0A8I3PNV3_BOK-01       gcagtccgagagcgtggtgactgacgccttcctggcggtggcatct----
A0A8I3S7I1_BOK-01       gcagtccgagagcgtggtgactgacgccttcctggcggtggcatct----
A0A8I3PNV3_BOK-03       gcagtccgagagcgtggtgactgacgccttcctggcggtggcatct----
A0A8I3S7I1_BOK-03       gcagtccgagagcgtggtgactgacgccttcctggcggtggcatct----
                             *   ***               ****       * **  *     

A0A8C0N8K9_BAX-03       -------------gagatgttttctgatggcaacttcaactggggccggg
A0A8C0N8K9_BAX-01       -------------gagatgttttctgatggcaacttcaactggggccggg
A0A8I3MD65_BAX-01       -------------gagatgttttctgatggcaacttcaactggggccggg
A0A8C0N8K9_BAX-02       -------------gagatgttttctgatggcaacttcaactggggccggg
A0A8I3MD65_BAX-02       -------------gagatgttttctgatggcaacttcaactggggccggg
A0A8C0MVC8_BAK1-01      ----------------agcctatttgagagcggcatcaactggggccgag
A0A8I3PJD5_BAK1-01      ----------------agcctatttgagagcggcatcaactggggccgag
A0A8C0MVC8_BAK1-02      cagcagcaacacccacagcctatttgagagcggcatcaactggggccgag
A0A8C0MVC8_BAK1-03      ----------------agcctatttgagagcggcatcaactggggccgag
A0A8I3PJD5_BAK1-02      -agcagcaacacccacagcctatttgagagcggcatcaactggggccgag
Q52HB2_BAK1-01          ----------------agcctatttgagagcggcatcaactggggccgag
A0A8I3PNV3_BOK-02       -------------cagatcttctctg---gaggcatcacatggggcaagg
A0A8C0PFA3_BOK-02       -------------cagatcttctctg---gaggcatcacatggggcaagg
A0A8I3S7I1_BOK-02       -------------cagatcttctctg---gaggcatcacatggggcaagg
A0A8C0PFA3_BOK-01       -------------cagatcttctctg---gaggcatcacatggggcaagg
A0A8I3PNV3_BOK-01       -------------cagatcttctctg---gaggcatcacatggggcaagg
A0A8I3S7I1_BOK-01       -------------cagatcttctctg---gaggcatcacatggggcaagg
A0A8I3PNV3_BOK-03       -------------cagatcttctctg---gaggcatcacatggggcaagg
A0A8I3S7I1_BOK-03       -------------cagatcttctctg---gaggcatcacatggggcaagg
                                        *   * * **   *   * ***  ******   *

A0A8C0N8K9_BAX-03       ttgttgccctcttctactttgccagcaaactggtg------------ctc
A0A8C0N8K9_BAX-01       ttgttgccctcttctactttgccagcaaactggtg------------ctc
A0A8I3MD65_BAX-01       ttgttgccctcttctactttgccagcaaactggtg------------ctc
A0A8C0N8K9_BAX-02       ttgttgccctcttctactttgccagcaaactggtg------------ctc
A0A8I3MD65_BAX-02       ttgttgccctcttctactttgccagcaaactggtg------------ctc
A0A8C0MVC8_BAK1-01      tggtg-----gctctcctgggcttt--ggctaccg---------------
A0A8I3PJD5_BAK1-01      tggtg-----gctctcctgggcttt--ggctaccg---------------
A0A8C0MVC8_BAK1-02      tggtg-----gctctcctgggcttt--ggctaccg---------------
A0A8C0MVC8_BAK1-03      tggtg-----gctctcctgggcttt--ggctaccg---------------
A0A8I3PJD5_BAK1-02      tggtg-----gctctcctgggcttt--ggctaccg---------------
Q52HB2_BAK1-01          tggtg-----gctctcctgggcttt--ggctaccg---------------
A0A8I3PNV3_BOK-02       tggtgtcgctgtactccgtggccgcagggctggcggtggactgtgtgcgg
A0A8C0PFA3_BOK-02       tggtgtcactgtactccgtggccgcagggctggcggtggactgtgtgcgg
A0A8I3S7I1_BOK-02       tggtgtcactgtactccgtggccgcagggctggcggtggactgtgtgcgg
A0A8C0PFA3_BOK-01       tggtgtcactgtactccgtggccgcagggctggcggtggactgtgtgcgg
A0A8I3PNV3_BOK-01       tggtgtcgctgtactccgtggccgcagggctggcggtggactgtgtgcgg
A0A8I3S7I1_BOK-01       tggtgtcactgtactccgtggccgcagggctggcggtggactgtgtgcgg
A0A8I3PNV3_BOK-03       tggtgtcgctgtactccgtggccgcagggctggcggtggactgtgtgcgg
A0A8I3S7I1_BOK-03       tggtgtcactgtactccgtggccgcagggctggcggtggactgtgtgcgg
                        * **         ** *   **       **   *               

A0A8C0N8K9_BAX-03       aaggccctgtgtaccaaggtgcccgagctgatcaggaccatcatgg----
A0A8C0N8K9_BAX-01       aaggccctgtgtaccaaggtgcccgagctgatcaggaccatcatgg----
A0A8I3MD65_BAX-01       aaggccctgtgtaccaaggtgcccgagctgatcaggaccatcatgg----
A0A8C0N8K9_BAX-02       aaggccctgtgtaccaaggtgcccgagctgatcaggaccatcatgg----
A0A8I3MD65_BAX-02       aaggccctgtgtaccaaggtgcccgagctgatcaggaccatcatgg----
A0A8C0MVC8_BAK1-01      --------------cctggccc---tgcatgtc--taccaacgcg-----
A0A8I3PJD5_BAK1-01      --------------cctggccc---tgcatgtc--taccaacgcg-----
A0A8C0MVC8_BAK1-02      --------------cctggccc---tgcatgtc--taccaacgcg-----
A0A8C0MVC8_BAK1-03      --------------cctggccc---tgcatgtc--taccaacgcg-----
A0A8I3PJD5_BAK1-02      --------------cctggccc---tgcatgtc--taccaacgcg-----
Q52HB2_BAK1-01          --------------cctggccc---tgcatgtc--taccaacgcg-----
A0A8I3PNV3_BOK-02       caggcccagcccgccctggtccacgcgctcgtc--gactgcctcggggag
A0A8C0PFA3_BOK-02       caggcccagcccgccctggtccacgcgctcgtc--gactgcctcggggag
A0A8I3S7I1_BOK-02       caggcccagcccgccctggtccacgcgctcgtc--gactgcctcggggag
A0A8C0PFA3_BOK-01       caggcccagcccgccctggtccacgcgctcgtc--gactgcctcggggag
A0A8I3PNV3_BOK-01       caggcccagcccgccctggtccacgcgctcgtc--gactgcctcggggag
A0A8I3S7I1_BOK-01       caggcccagcccgccctggtccacgcgctcgtc--gactgcctcggggag
A0A8I3PNV3_BOK-03       caggcccagcccgccctggtccacgcgctcgtc--gactgcctcggggag
A0A8I3S7I1_BOK-03       caggcccagcccgccctggtccacgcgctcgtc--gactgcctcggggag
                                      *  **  *    **   **   **   *  *     

A0A8C0N8K9_BAX-03       -------gctggacactggacttcct------------------------
A0A8C0N8K9_BAX-01       -------gctggacactggacttcct------------------------
A0A8I3MD65_BAX-01       -------gctggacactggacttcct------------------------
A0A8C0N8K9_BAX-02       -------gctggacactggacttcct------------------------
A0A8I3MD65_BAX-02       -------gctggacactggacttcct------------------------
A0A8C0MVC8_BAK1-01      -------gcctgac---cggcttcctgggccaggtgac------------
A0A8I3PJD5_BAK1-01      -------gcctgac---cggcttcctgggccaggtgac------------
A0A8C0MVC8_BAK1-02      -------gcctga-------------------------------------
A0A8C0MVC8_BAK1-03      -------gcctgac---cggcttcctgggccaggtgac------------
A0A8I3PJD5_BAK1-02      -------gcctgac---cggcttcctgggccaggtgac------------
Q52HB2_BAK1-01          -------gcctgac---cggcttcctgggccaggtgac------------
A0A8I3PNV3_BOK-02       ttcgtgcgcaagaccc-tggcgccctggctgcggaggcgcggaggatggg
A0A8C0PFA3_BOK-02       ttcgtgcgcaagacccttggcgccctggctgcggaggcgcggaggatggg
A0A8I3S7I1_BOK-02       ttcgtgcgcaagaccc-tggcgccctggctgcggaggcgcggaggatggg
A0A8C0PFA3_BOK-01       ttcgtgcgcaagacccttggcgccctggctgcggaggcgcggaggatgg-
A0A8I3PNV3_BOK-01       ttcgtgcgcaagaccc-tggcgccctggctgcggaggcgcggaggatgg-
A0A8I3S7I1_BOK-01       ttcgtgcgcaagaccc-tggcgccctggctgcggaggcgcggaggatgg-
A0A8I3PNV3_BOK-03       ttcgtgcgcaagaccc-tggcgccctggctgcggaggcgcggaggatggg
A0A8I3S7I1_BOK-03       ttcgtgcgcaagaccc-tggcgccctggctgcggaggcgcggaggatggg
                               **  **                                     

A0A8C0N8K9_BAX-03       --------------------------------------------------
A0A8C0N8K9_BAX-01       --------------------------------------------------
A0A8I3MD65_BAX-01       --------------------------------------------------
A0A8C0N8K9_BAX-02       --------------------------------------------------
A0A8I3MD65_BAX-02       --------------------------------------------------
A0A8C0MVC8_BAK1-01      --------------------------------------------------
A0A8I3PJD5_BAK1-01      --------------------------------------------------
A0A8C0MVC8_BAK1-02      --------------------------------------------------
A0A8C0MVC8_BAK1-03      --------------------------------------------------
A0A8I3PJD5_BAK1-02      --------------------------------------------------
Q52HB2_BAK1-01          --------------------------------------------------
A0A8I3PNV3_BOK-02       tgaggggtgccggggggtgcgctgctgcgggggggtgctggggctcggct
A0A8C0PFA3_BOK-02       tgaggggtgcgggggggtgcgctgctgcgggggggtgctggggctcggct
A0A8I3S7I1_BOK-02       tgaggggtgcgggggggtgcgctgctgcgggggggtgctggggctcggct
A0A8C0PFA3_BOK-01       --------------------------------------------------
A0A8I3PNV3_BOK-01       --------------------------------------------------
A0A8I3S7I1_BOK-01       --------------------------------------------------
A0A8I3PNV3_BOK-03       tgaggggtgccggggggtgcgctgctgcgggggggtgctggggctcggct
A0A8I3S7I1_BOK-03       tgaggggtgcgggggggtgcgctgctgcgggggggtgctggggctcggct
                                                                          

A0A8C0N8K9_BAX-03       ----------------tcgagagcggc--------tgctgggctggatcc
A0A8C0N8K9_BAX-01       ----------------tcgagagcggc--------tgctgggctggatcc
A0A8I3MD65_BAX-01       ----------------tcgagagcggc--------tgctgggctggatcc
A0A8C0N8K9_BAX-02       ----------------tcgagagcggc--------tgctgggctggatcc
A0A8I3MD65_BAX-02       ----------------tcgagagcggc--------tgctgggctggatcc
A0A8C0MVC8_BAK1-01      -----------ccgcttcgtggccgactt----catgctgcatcattgca
A0A8I3PJD5_BAK1-01      -----------ccgcttcgtggccgactt----catgctgcatcattgca
A0A8C0MVC8_BAK1-02      --------------------------------------------------
A0A8C0MVC8_BAK1-03      -----------ccgcttcgtggccgactt----catgctgcatcattgca
A0A8I3PJD5_BAK1-02      -----------ccgcttcgtggccgactt----catgctgcatcattgca
Q52HB2_BAK1-01          -----------ccgcttcgtggccgactt----catgctgcatcattgca
A0A8I3PNV3_BOK-02       gctcgcactgcccggctccctgccgacctgccctccgctcccccgagccc
A0A8C0PFA3_BOK-02       gctcgcactgcccggctccctgccgacctgccctctgctcccccgagccc
A0A8I3S7I1_BOK-02       gctcgcactgcccggctccctgccgacctgccctctgctcccccgagccc
A0A8C0PFA3_BOK-01       ---------------------accgacgt-----------cctcaag---
A0A8I3PNV3_BOK-01       ---------------------accgacgt-----------cctcaag---
A0A8I3S7I1_BOK-01       ---------------------accgacgt-----------cctcaag---
A0A8I3PNV3_BOK-03       gctcgcactgcccggctccctgccgacctgccctccgctcccccgagccc
A0A8I3S7I1_BOK-03       gctcgcactgcccggctccctgccgacctgccctctgctcccccgagccc
                                                                          

A0A8C0N8K9_BAX-03       aggaccagggtggt------------------------------------
A0A8C0N8K9_BAX-01       aggaccagggtggt------------------------------------
A0A8I3MD65_BAX-01       aggaccagggtggt------------------------------------
A0A8C0N8K9_BAX-02       aggaccagggtggt------------------------------------
A0A8I3MD65_BAX-02       aggaccagggtggt------------------------------------
A0A8C0MVC8_BAK1-01      ttgcccggtg----------------------------------------
A0A8I3PJD5_BAK1-01      ttgcccggtg----------------------------------------
A0A8C0MVC8_BAK1-02      --------------------------------------------------
A0A8C0MVC8_BAK1-03      ttgcccggtg----------------------------------------
A0A8I3PJD5_BAK1-02      ttgcccggtg----------------------------------------
Q52HB2_BAK1-01          ttgcccggtg----------------------------------------
A0A8I3PNV3_BOK-02       aggccccgcggggcaggagctgcccgggagggatcgcccgtcactgccca
A0A8C0PFA3_BOK-02       aggccccgcggggcaggagctgcccgggagggatcgcccgtcactgccca
A0A8I3S7I1_BOK-02       aggccccgcggggcaggagctgcccgggagggatcgcccgtcactgccca
A0A8C0PFA3_BOK-01       ------tgtgtgg-------------------------------------
A0A8I3PNV3_BOK-01       ------tgtgtgg-------------------------------------
A0A8I3S7I1_BOK-01       ------tgtgtgg-------------------------------------
A0A8I3PNV3_BOK-03       aggccccgcggggcaggagctgcccgggagggatcgcccgtcactgccca
A0A8I3S7I1_BOK-03       aggccccgcggggcaggagctgcccgggagggatcgcccgtcactgccca
                                                                          

A0A8C0N8K9_BAX-03       --------------------------------------------------
A0A8C0N8K9_BAX-01       --------------------------------------------------
A0A8I3MD65_BAX-01       --------------------------------------------------
A0A8C0N8K9_BAX-02       --------------------------------------------------
A0A8I3MD65_BAX-02       --------------------------------------------------
A0A8C0MVC8_BAK1-01      ---------------------------------gatcgcgcag-------
A0A8I3PJD5_BAK1-01      ---------------------------------gatcgcgcag-------
A0A8C0MVC8_BAK1-02      --------------------------------------------------
A0A8C0MVC8_BAK1-03      ---------------------------------gatcgcgcag-------
A0A8I3PJD5_BAK1-02      ---------------------------------gatcgcgcag-------
Q52HB2_BAK1-01          ---------------------------------gatcgcgcag-------
A0A8I3PNV3_BOK-02       ggccccgcgccgggcgcccccaccacggcctccgagcccgcagtcgcccg
A0A8C0PFA3_BOK-02       ggccccgcgccgggcgcccccaccacggcctccgagcccgcagccgcccg
A0A8I3S7I1_BOK-02       ggccccgcgccgggcgcccccaccacggcctccgagcccgcagccgcctg
A0A8C0PFA3_BOK-01       --------------------------------tgagcacggagcc-----
A0A8I3PNV3_BOK-01       --------------------------------tgagcacggagcc-----
A0A8I3S7I1_BOK-01       --------------------------------tgagcacggagcc-----
A0A8I3PNV3_BOK-03       ggccccgcgccgggcgcccccaccacggcctccgagcccgcagtcgcccg
A0A8I3S7I1_BOK-03       ggccccgcgccgggcgcccccaccacggcctccgagcccgcagccgcctg
                                                                          

A0A8C0N8K9_BAX-03       -------------------tgggacggcctcctctcctactttgggacac
A0A8C0N8K9_BAX-01       -------------------tgggacggcctcctctcctactttgggacac
A0A8I3MD65_BAX-01       -------------------tgggacggcctcctctcctactttgggacac
A0A8C0N8K9_BAX-02       -------------------tgggacggcctcctctcctactttgggacac
A0A8I3MD65_BAX-02       -------------------tgggacggcctcctctcctactttgggacac
A0A8C0MVC8_BAK1-01      -------------------aggggtggc----------------------
A0A8I3PJD5_BAK1-01      -------------------aggggtggc----------------------
A0A8C0MVC8_BAK1-02      --------------------------------------------------
A0A8C0MVC8_BAK1-03      -------------------aggggtggc----------------------
A0A8I3PJD5_BAK1-02      -------------------aggggtggc----------------------
Q52HB2_BAK1-01          -------------------aggggtggc----------------------
A0A8I3PNV3_BOK-02       cccaccccggccgggcctcgggcgcagcccccac----aggagagctcac
A0A8C0PFA3_BOK-02       cccaccccggccgggcctcgggcgcagcccccac----aggagagctcac
A0A8I3S7I1_BOK-02       cccaccccggccgggcctcgggcgcagcccccac----aggagagctcac
A0A8C0PFA3_BOK-01       ------------------------cggcttcc------------gctcgc
A0A8I3PNV3_BOK-01       ------------------------cggcttcc------------gctcgc
A0A8I3S7I1_BOK-01       ------------------------cggcttcc------------gctcgc
A0A8I3PNV3_BOK-03       cccaccccggccgggcctcgggcgcagcccccac----aggagagctcac
A0A8I3S7I1_BOK-03       cccaccccggccgggcctcgggcgcagcccccac----aggagagctcac
                                                                          

A0A8C0N8K9_BAX-03       ccacgtggcagacagtgaccatctttgtggctggag--------------
A0A8C0N8K9_BAX-01       ccacgtggcagacagtgaccatctttgtggctggag--------------
A0A8I3MD65_BAX-01       ccacgtggcagacagtgaccatctttgtggctggag--------------
A0A8C0N8K9_BAX-02       ccacgtggcagacagtgaccatctttgtggctggag--------------
A0A8I3MD65_BAX-02       ccacgtggcagacagtgaccatctttgtggctggag--------------
A0A8C0MVC8_BAK1-01      -----tgggtggcagccctgaacttgggaa--------------------
A0A8I3PJD5_BAK1-01      -----tgggtggcagccctgaacttgggaa--------------------
A0A8C0MVC8_BAK1-02      --------------------------------------------------
A0A8C0MVC8_BAK1-03      -----tgggtggcagccctgaacttgggaa--------------------
A0A8I3PJD5_BAK1-02      -----tgggtggcagccctgaacttgggaa--------------------
Q52HB2_BAK1-01          -----tgggtggcagccctgaacttgggaa--------------------
A0A8I3PNV3_BOK-02       ccctatgggtggcggccgagggcgctggagctcgggccggggctgccccc
A0A8C0PFA3_BOK-02       ccgtatgggtggcggccgagggcgctggagctcgggccggggctgccccc
A0A8I3S7I1_BOK-02       ccgtatgggtggcggccgagggcgctggagctcgggccggggctgccccc
A0A8C0PFA3_BOK-01       ac---tggctggtggccgc--gctctgcagcttcggcc------------
A0A8I3PNV3_BOK-01       ac---tggctggtggccgc--gctctgcagcttcggcc------------
A0A8I3S7I1_BOK-01       ac---tggctggtggccgc--gctctgcagcttcggcc------------
A0A8I3PNV3_BOK-03       ccctatgggtggcggccgagggcgctggagctcgggccggggctgccccc
A0A8I3S7I1_BOK-03       ccgtatgggtggcggccgagggcgctggagctcgggccggggctgccccc
                                                                          

A0A8C0N8K9_BAX-03       --------------------------------------------tgctta
A0A8C0N8K9_BAX-01       --------------------------------------------tgctta
A0A8I3MD65_BAX-01       --------------------------------------------tgctta
A0A8C0N8K9_BAX-02       --------------------------------------------tgctta
A0A8I3MD65_BAX-02       --------------------------------------------tgctta
A0A8C0MVC8_BAK1-01      ---------------------------------------acggccccatc
A0A8I3PJD5_BAK1-01      ---------------------------------------acggccccatc
A0A8C0MVC8_BAK1-02      --------------------------------------------------
A0A8C0MVC8_BAK1-03      ---------------------------------------acggccccatc
A0A8I3PJD5_BAK1-02      ---------------------------------------acggccccatc
Q52HB2_BAK1-01          ---------------------------------------acggccccatc
A0A8I3PNV3_BOK-02       gggacccgggctgcggccagtcctcagcacagacccgacgccgctgcctc
A0A8C0PFA3_BOK-02       gggacccgggctgtggccagtcctcagcacagacccgacgccgctgcctc
A0A8I3S7I1_BOK-02       gggacccgggctgtggccagtcctcagcacagacccgacgccgctgcctc
A0A8C0PFA3_BOK-01       ---------------------------------------------gcttc
A0A8I3PNV3_BOK-01       ---------------------------------------------gcttc
A0A8I3S7I1_BOK-01       ---------------------------------------------gcttc
A0A8I3PNV3_BOK-03       gggacccgggctgcggccagtcctcagcacagacccgacgccgctgcctc
A0A8I3S7I1_BOK-03       gggacccgggctgtggccagtcctcagcacagacccgacgccgctgcctc
                                                                          

A0A8C0N8K9_BAX-03       ctg-----------------------------------------------
A0A8C0N8K9_BAX-01       ctg-----------------------------------------------
A0A8I3MD65_BAX-01       ctg-----------------------------------------------
A0A8C0N8K9_BAX-02       ctg-----------------------------------------------
A0A8I3MD65_BAX-02       ctg-----------------------------------------------
A0A8C0MVC8_BAK1-01      ctg-----------------------------------------------
A0A8I3PJD5_BAK1-01      ctg-----------------------------------------------
A0A8C0MVC8_BAK1-02      --------------------------------------------------
A0A8C0MVC8_BAK1-03      ctg-----------------------------------------------
A0A8I3PJD5_BAK1-02      ctg-----------------------------------------------
Q52HB2_BAK1-01          ctg-----------------------------------------------
A0A8I3PNV3_BOK-02       ctgcctgccgcgcggcctctgctatggacgccagtgggctccgcggtcga
A0A8C0PFA3_BOK-02       ctgcctgctgcgcggcctctgctatggacgccagtgggctccacggtcga
A0A8I3S7I1_BOK-02       ctgcctgctgcgcggcctctgctatggacgccagtgggctccacggtcga
A0A8C0PFA3_BOK-01       ctg-----------------------------------------------
A0A8I3PNV3_BOK-01       ctg-----------------------------------------------
A0A8I3S7I1_BOK-01       ctg-----------------------------------------------
A0A8I3PNV3_BOK-03       ctgcctgccgcgcggcctctgctatggacgccagtgggctccgcggtcga
A0A8I3S7I1_BOK-03       ctgcctgctgcgcggcctctgctatggacgccagtgggctccacggtcga
                                                                          

A0A8C0N8K9_BAX-03       ----------------cgtcactcaccatctggaaaaagatgggctga--
A0A8C0N8K9_BAX-01       ----------------cgtcactcaccatctggaaaaagatgggctga--
A0A8I3MD65_BAX-01       ----------------cgtcactcaccatctggaaaaagatgggctga--
A0A8C0N8K9_BAX-02       ----------------cgtcactcaccatctggaaaaagatgggctga--
A0A8I3MD65_BAX-02       ----------------cgtcactcaccatctggaaaaagatgggctga--
A0A8C0MVC8_BAK1-01      --------------------------------------aacgtgctgata
A0A8I3PJD5_BAK1-01      --------------------------------------aacgtgctgata
A0A8C0MVC8_BAK1-02      --------------------------------------------------
A0A8C0MVC8_BAK1-03      --------------------------------------aacgtgctgata
A0A8I3PJD5_BAK1-02      --------------------------------------aacgtgctgata
Q52HB2_BAK1-01          --------------------------------------aacgtgctgata
A0A8I3PNV3_BOK-02       ggtccagagcgcagggcagatttcattcccagcaggagaaagaactgggc
A0A8C0PFA3_BOK-02       ggtccagagcacagggcagatttcattcccagcaggagaaagaactgggc
A0A8I3S7I1_BOK-02       ggtccagagcacagggcagatttcattcccagcaggagaaagaactgggc
A0A8C0PFA3_BOK-01       ------------aaggccgccttc--------------------------
A0A8I3PNV3_BOK-01       ------------aaggccgccttc--------------------------
A0A8I3S7I1_BOK-01       ------------aaggccgccttc--------------------------
A0A8I3PNV3_BOK-03       ggtccagagcgcagggcagatttcattcccagcaggagaaagaactgggc
A0A8I3S7I1_BOK-03       ggtccagagcacagggcagatttcattcccagcaggagaaagaactgggc
                                                                          

A0A8C0N8K9_BAX-03       --------------------------------------------------
A0A8C0N8K9_BAX-01       --------------------------------------------------
A0A8I3MD65_BAX-01       --------------------------------------------------
A0A8C0N8K9_BAX-02       --------------------------------------------------
A0A8I3MD65_BAX-02       --------------------------------------------------
A0A8C0MVC8_BAK1-01      gtgctgtctgtggttctgttgggccagttt--------------------
A0A8I3PJD5_BAK1-01      gtgctgtctgtggttctgttgggccagttt--------------------
A0A8C0MVC8_BAK1-02      --------------------------------------------------
A0A8C0MVC8_BAK1-03      gtgctgtctgtggttctgttgggccagttt--------------------
A0A8I3PJD5_BAK1-02      gtgctgtctgtggttctgttgggccagttt--------------------
Q52HB2_BAK1-01          gtgctgtctgtggttctgttgggccagttt--------------------
A0A8I3PNV3_BOK-02       ctgctgctcgggcttgtggggagccggtcccacccgttctggggggcagt
A0A8C0PFA3_BOK-02       ctgctgctcgggcttgtggggagccggtcccacccgttctggggggcagt
A0A8I3S7I1_BOK-02       ctgctgctcgggcttgtggggagccggtcccacccgttctggggggcagt
A0A8C0PFA3_BOK-01       ------ctcgtgct------------------------------------
A0A8I3PNV3_BOK-01       ------ctcgtgct------------------------------------
A0A8I3S7I1_BOK-01       ------ctcgtgct------------------------------------
A0A8I3PNV3_BOK-03       ctgctgctcgggcttgtggggagccggtcccacccgttctggggggcagt
A0A8I3S7I1_BOK-03       ctgctgctcgggcttgtggggagccggtcccacccgttctggggggcagt
                                                                          

A0A8C0N8K9_BAX-03       --------------------------------------------------
A0A8C0N8K9_BAX-01       --------------------------------------------------
A0A8I3MD65_BAX-01       --------------------------------------------------
A0A8C0N8K9_BAX-02       --------------------------------------------------
A0A8I3MD65_BAX-02       --------------------------------------------------
A0A8C0MVC8_BAK1-01      ----------------------------------gtgcctacaggtctgg
A0A8I3PJD5_BAK1-01      ----------------------------------gtgcctacaggtctgg
A0A8C0MVC8_BAK1-02      --------------------------------------------------
A0A8C0MVC8_BAK1-03      ----------------------------------gtg-------------
A0A8I3PJD5_BAK1-02      ----------------------------------gtg-------------
Q52HB2_BAK1-01          ----------------------------------gtg-------------
A0A8I3PNV3_BOK-02       gcgccatggtgctccccaggcgggggctgcgggggcgtctgcagccccgg
A0A8C0PFA3_BOK-02       gcgccatggtgctccccaggcgggggctgcgggggcgtctgcagccccgg
A0A8I3S7I1_BOK-02       gcgccatggtgctccccaggcgggggctgcgggggcgtctgcagccccgg
A0A8C0PFA3_BOK-01       -------------------------gctgccagag---------------
A0A8I3PNV3_BOK-01       -------------------------gctgccggag---------------
A0A8I3S7I1_BOK-01       -------------------------gctgccggag---------------
A0A8I3PNV3_BOK-03       gcgccatggtgctccccaggcgggggctgcgggggcgtctgcagccccgg
A0A8I3S7I1_BOK-03       gcgccatggtgctccccaggcgggggctgcgggggcgtctgcagccccgg
                                                                          

A0A8C0N8K9_BAX-03       --------------------------------------------------
A0A8C0N8K9_BAX-01       --------------------------------------------------
A0A8I3MD65_BAX-01       --------------------------------------------------
A0A8C0N8K9_BAX-02       --------------------------------------------------
A0A8I3MD65_BAX-02       --------------------------------------------------
A0A8C0MVC8_BAK1-01      gggaaaggagagagaagttcatgattaagccaaatgcagggagcggatgc
A0A8I3PJD5_BAK1-01      gggaaaggagagagaagttcatgattaagccaaatgcagggagcggatgc
A0A8C0MVC8_BAK1-02      --------------------------------------------------
A0A8C0MVC8_BAK1-03      --------------------------------------------------
A0A8I3PJD5_BAK1-02      --------------------------------------------------
Q52HB2_BAK1-01          --------------------------------------------------
A0A8I3PNV3_BOK-02       gggcaggagcaggtggctgcggggacacgggcacagcgggcttctctcct
A0A8C0PFA3_BOK-02       gggcaggagcaggtggctgcggggacacgggcacagcgggcttctctcct
A0A8I3S7I1_BOK-02       gggcaggagcaggtggctgcggggacacgggcacagcgggcttctctcct
A0A8C0PFA3_BOK-01       ----------agatgagcggccggagcgcgctcgggctgaagccaggccc
A0A8I3PNV3_BOK-01       ----------agatga----------------------------------
A0A8I3S7I1_BOK-01       ----------agatga----------------------------------
A0A8I3PNV3_BOK-03       gggcaggagcaggtggctgcggggacacgggcacagcgggcttctctcct
A0A8I3S7I1_BOK-03       gggcaggagcaggtggctgcggggacacgggcacagcgggcttctctcct
                                                                          

A0A8C0N8K9_BAX-03       --------------------------------------------------
A0A8C0N8K9_BAX-01       --------------------------------------------------
A0A8I3MD65_BAX-01       --------------------------------------------------
A0A8C0N8K9_BAX-02       --------------------------------------------------
A0A8I3MD65_BAX-02       --------------------------------------------------
A0A8C0MVC8_BAK1-01      agatggagcccgctgaccagcccccaccctctgagtgtgtct--------
A0A8I3PJD5_BAK1-01      agatggagcccgctgaccagcccccaccctctgagtgtgtct--------
A0A8C0MVC8_BAK1-02      --------------------------------------------------
A0A8C0MVC8_BAK1-03      --------------------------------------gtac--------
A0A8I3PJD5_BAK1-02      --------------------------------------gtac--------
Q52HB2_BAK1-01          --------------------------------------gtac--------
A0A8I3PNV3_BOK-02       gccgggcccgcggccgcctcgggctccccgtcctccccgtcctcccgggt
A0A8C0PFA3_BOK-02       gccgggcccgcggccgcctcgggctccccgtcctccctgtcctcccgggt
A0A8I3S7I1_BOK-02       gccgggcccgcggccgcctcgggctccccgtcctccctgtcctcccgggt
A0A8C0PFA3_BOK-01       cccgagcccggggccccgcgcacggcctcggcctcctcgcccggcctggg
A0A8I3PNV3_BOK-01       --------------------------------------------------
A0A8I3S7I1_BOK-01       --------------------------------------------------
A0A8I3PNV3_BOK-03       gccgggcccgcggccgcctcgggctccccgtcctccccgtcctcccgggt
A0A8I3S7I1_BOK-03       gccgggcccgcggccgcctcgggctccccgtcctccctgtcctcccgggt
                                                                          

A0A8C0N8K9_BAX-03       --------------------------------------------------
A0A8C0N8K9_BAX-01       --------------------------------------------------
A0A8I3MD65_BAX-01       --------------------------------------------------
A0A8C0N8K9_BAX-02       --------------------------------------------------
A0A8I3MD65_BAX-02       --------------------------------------------------
A0A8C0MVC8_BAK1-01      ---------------gaaaat-----aaactgtaa---------------
A0A8I3PJD5_BAK1-01      ---------------gaaaat-----aaactgtaa---------------
A0A8C0MVC8_BAK1-02      --------------------------------------------------
A0A8C0MVC8_BAK1-03      ---------------gaagattcttcaaatcatga---------------
A0A8I3PJD5_BAK1-02      ---------------gaagattcttcaaatcatga---------------
Q52HB2_BAK1-01          ---------------gaagattcttcaaatcatga---------------
A0A8I3PNV3_BOK-02       tgggctgccccacggggacctcccctaa----------------------
A0A8C0PFA3_BOK-02       tgggctgccccacggggacctcccctaaggcctcggcggcccccactcgt
A0A8I3S7I1_BOK-02       tgggctgccccacggggacctcccctaa----------------------
A0A8C0PFA3_BOK-01       agtgcgccggccgtcggggccccacctcggggctggaggccctgccctga
A0A8I3PNV3_BOK-01       --------------------------------------------------
A0A8I3S7I1_BOK-01       --------------------------------------------------
A0A8I3PNV3_BOK-03       tgggctgccccacggggacctcccctaa----------------------
A0A8I3S7I1_BOK-03       tgggctgccccacggggacctcccctaa----------------------
                                                                          

A0A8C0N8K9_BAX-03       --------------------------------------------------
A0A8C0N8K9_BAX-01       --------------------------------------------------
A0A8I3MD65_BAX-01       --------------------------------------------------
A0A8C0N8K9_BAX-02       --------------------------------------------------
A0A8I3MD65_BAX-02       --------------------------------------------------
A0A8C0MVC8_BAK1-01      --------------------------------------------------
A0A8I3PJD5_BAK1-01      --------------------------------------------------
A0A8C0MVC8_BAK1-02      --------------------------------------------------
A0A8C0MVC8_BAK1-03      --------------------------------------------------
A0A8I3PJD5_BAK1-02      --------------------------------------------------
Q52HB2_BAK1-01          --------------------------------------------------
A0A8I3PNV3_BOK-02       --------------------------------------------------
A0A8C0PFA3_BOK-02       ctctaacccaccctctcccctccagaccgacgtcctcaagtgtgtggtga
A0A8I3S7I1_BOK-02       --------------------------------------------------
A0A8C0PFA3_BOK-01       --------------------------------------------------
A0A8I3PNV3_BOK-01       --------------------------------------------------
A0A8I3S7I1_BOK-01       --------------------------------------------------
A0A8I3PNV3_BOK-03       --------------------------------------------------
A0A8I3S7I1_BOK-03       --------------------------------------------------
                                                                          

A0A8C0N8K9_BAX-03       --------------------------------------------------
A0A8C0N8K9_BAX-01       --------------------------------------------------
A0A8I3MD65_BAX-01       --------------------------------------------------
A0A8C0N8K9_BAX-02       --------------------------------------------------
A0A8I3MD65_BAX-02       --------------------------------------------------
A0A8C0MVC8_BAK1-01      --------------------------------------------------
A0A8I3PJD5_BAK1-01      --------------------------------------------------
A0A8C0MVC8_BAK1-02      --------------------------------------------------
A0A8C0MVC8_BAK1-03      --------------------------------------------------
A0A8I3PJD5_BAK1-02      --------------------------------------------------
Q52HB2_BAK1-01          --------------------------------------------------
A0A8I3PNV3_BOK-02       --------------------------------------------------
A0A8C0PFA3_BOK-02       gcacggagcccggcttccgctcgcactggctggtggccgcgctctgcagc
A0A8I3S7I1_BOK-02       --------------------------------------------------
A0A8C0PFA3_BOK-01       --------------------------------------------------
A0A8I3PNV3_BOK-01       --------------------------------------------------
A0A8I3S7I1_BOK-01       --------------------------------------------------
A0A8I3PNV3_BOK-03       --------------------------------------------------
A0A8I3S7I1_BOK-03       --------------------------------------------------
                                                                          

A0A8C0N8K9_BAX-03       --------------------------------------------------
A0A8C0N8K9_BAX-01       --------------------------------------------------
A0A8I3MD65_BAX-01       --------------------------------------------------
A0A8C0N8K9_BAX-02       --------------------------------------------------
A0A8I3MD65_BAX-02       --------------------------------------------------
A0A8C0MVC8_BAK1-01      --------------------------------------------------
A0A8I3PJD5_BAK1-01      --------------------------------------------------
A0A8C0MVC8_BAK1-02      --------------------------------------------------
A0A8C0MVC8_BAK1-03      --------------------------------------------------
A0A8I3PJD5_BAK1-02      --------------------------------------------------
Q52HB2_BAK1-01          --------------------------------------------------
A0A8I3PNV3_BOK-02       --------------------------------------------------
A0A8C0PFA3_BOK-02       ttcggccgcttcctgaaggccgccttcctcgtgctgctgccagagagatg
A0A8I3S7I1_BOK-02       --------------------------------------------------
A0A8C0PFA3_BOK-01       --------------------------------------------------
A0A8I3PNV3_BOK-01       --------------------------------------------------
A0A8I3S7I1_BOK-01       --------------------------------------------------
A0A8I3PNV3_BOK-03       --------------------------------------------------
A0A8I3S7I1_BOK-03       --------------------------------------------------
                                                                          

A0A8C0N8K9_BAX-03       -
A0A8C0N8K9_BAX-01       -
A0A8I3MD65_BAX-01       -
A0A8C0N8K9_BAX-02       -
A0A8I3MD65_BAX-02       -
A0A8C0MVC8_BAK1-01      -
A0A8I3PJD5_BAK1-01      -
A0A8C0MVC8_BAK1-02      -
A0A8C0MVC8_BAK1-03      -
A0A8I3PJD5_BAK1-02      -
Q52HB2_BAK1-01          -
A0A8I3PNV3_BOK-02       -
A0A8C0PFA3_BOK-02       a
A0A8I3S7I1_BOK-02       -
A0A8C0PFA3_BOK-01       -
A0A8I3PNV3_BOK-01       -
A0A8I3S7I1_BOK-01       -
A0A8I3PNV3_BOK-03       -
A0A8I3S7I1_BOK-03       -
                         

© 1998-2023Legal notice