Dataset for CDS BAX of Organism Astatotilapia calliptera

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P8N5H5_BAX-01      atgatggttcgtacggagtatctgaactgtggaagaacacaaagtaaaac
A0A3P8N5H5_BAX-02      --------------------------------------------------
A0A3P8NNW3_BAX-01      atg----ct-----------------------------------------
A0A3P8NNH7_BAX-03      atg----ct-----------------------------------------
A0A3P8NNH7_BAX-01      atggcatca-----------------------------------------
                                                                         

A0A3P8N5H5_BAX-01      agataaatactcctctgtgggcaggtttctgggcgagtatctccatctgt
A0A3P8N5H5_BAX-02      --------------------------------------------------
A0A3P8NNW3_BAX-01      -------tatttatcagcatttgagtcatctaatgagtgtct--------
A0A3P8NNH7_BAX-03      -------tatttatcagcatttgagtcatctaatgagtgtct--------
A0A3P8NNH7_BAX-01      -------cacccaggagga----ggcgatcaaggtagtagca--------
                                                                         

A0A3P8N5H5_BAX-01      gggatttctgtgaggcgtgtctacggactgctggtcccgtcgctacgata
A0A3P8N5H5_BAX-02      --------------------------------------------------
A0A3P8NNW3_BAX-01      --------------------------------------------------
A0A3P8NNH7_BAX-03      --------------------------------------------------
A0A3P8NNH7_BAX-01      --------------------------------------------------
                                                                         

A0A3P8N5H5_BAX-01      cttccgtatcacttccgtgtgcttctgttgaaaggcgggtttccacagac
A0A3P8N5H5_BAX-02      --------------------------------------------------
A0A3P8NNW3_BAX-01      --------------------------------------------------
A0A3P8NNH7_BAX-03      --------------------------------------------------
A0A3P8NNH7_BAX-01      --------------------------------------------------
                                                                         

A0A3P8N5H5_BAX-01      taggtttggctccatggctgacggccgaggggggcagaatccggagc--a
A0A3P8N5H5_BAX-02      -------------atggctgacggccgaggggggcagaatccggagc--a
A0A3P8NNW3_BAX-01      -------------acctttgtctttcatgg------aattccggaga---
A0A3P8NNH7_BAX-03      -------------acctttgtctttcaggg------aattccggaga---
A0A3P8NNH7_BAX-01      -------------gctatcgtcaacaaata------aaatacatatattt
                                          * *               * * *  *     

A0A3P8N5H5_BAX-01      ggagccgaggggcgccgcgggtggagacgatgtcgttga---------tg
A0A3P8N5H5_BAX-02      ggagccgaggggcgccgcgggtggagacgatgtcgttga---------tg
A0A3P8NNW3_BAX-01      ----tc---agatactggaagtcggaactattttgttaca--------gg
A0A3P8NNH7_BAX-03      ----tc---agatactggaagtcggaactattttgttaca--------gg
A0A3P8NNH7_BAX-01      cgactc---tgacagtgtcggtgggagtccgatagacacagataatgtgg
                            *    *     *   ** *        * *              *

A0A3P8N5H5_BAX-01      attccatcctcgaagaaggtgcggttgtctttagagggtatgtgattgca
A0A3P8N5H5_BAX-02      attccatcctcgaagaaggtgcggttgtctttagagggtatgtgattgca
A0A3P8NNW3_BAX-01      atttcatctatgagcgag-----------ttcagaggcaaagagatggca
A0A3P8NNH7_BAX-03      atttcatctatgagcgag-----------ttcagaggcaaggagatggca
A0A3P8NNH7_BAX-01      ctttcatctatgagcgag-----------ttcagaggcaaggagatggca
                        ** ****   **   **           ** *****  * * *** ***

A0A3P8N5H5_BAX-01      catataaacacagaggagcccagtcgacacgtgacttctgaggatttggg
A0A3P8N5H5_BAX-02      catataaacacagaggagcccagtcgacacgtgacttctgaggatttggg
A0A3P8NNW3_BAX-01      ---------atagtgca-------------gtgacgagagaacagcttga
A0A3P8NNH7_BAX-03      ---------ataaggca-------------gtgacgagagaacagcttgg
A0A3P8NNH7_BAX-01      ---------ataaggca-------------gtgacgagagaacagcttgg
                                * *  * *             *****    **  *  * * 

A0A3P8N5H5_BAX-01      aggaaggccagatgaacaacaggatccacaagtcaaagaagtggtagaac
A0A3P8N5H5_BAX-02      aggaaggccagatgaacaacaggatccacaagtcaaagaagtggtagaac
A0A3P8NNW3_BAX-01      tggaa-gccagctgact-----gacccaaaacataagaagcttgctcagt
A0A3P8NNH7_BAX-03      tggaa-gccagctgact-----gacccaaaacataagaagcttgctcagt
A0A3P8NNH7_BAX-01      tggaa-gccagctgact-----gacccaaaacataagaagcttgctcagt
                        **** ***** ***       ** *** **   **  *  * *   *  

A0A3P8N5H5_BAX-01      agctgcgcaagatagccgacagtttaaaccgcaatgctgagcttcagaga
A0A3P8N5H5_BAX-02      agctgcgcaagatagccgacagtttaaaccgcaatgctgagcttcagaga
A0A3P8NNW3_BAX-01      gcctgcagcatattggagacgagctggatggaaatgtagagctccaaaga
A0A3P8NNH7_BAX-03      gcctgcagcagattggagacgagctggatggaaatgtagagctccaaaga
A0A3P8NNH7_BAX-01      gcctgcagcagattggagacgagctggatggaaatgtagagctccaaaga
                         ****   * ** *  ***    *  *  * ****  ***** ** ***

A0A3P8N5H5_BAX-01      ctgataaaccaggttcaggggaactgcgttc-----aagatgtcttcatg
A0A3P8N5H5_BAX-02      ctgataaaccaggttcaggggaactgcgttc-----aagatgtcttcatg
A0A3P8NNW3_BAX-01      atgataaataactcttcg-----ctttgtcccacaagaaaggtttttatg
A0A3P8NNH7_BAX-03      atgataaatgactcttcg-----ctttgtcccacaagagaggtttttatg
A0A3P8NNH7_BAX-01      atgataaatgactcttcg-----ctttgtcccacaagagaggtttttatg
                        *******  *   *  *     **  ** *      * * ** ** ***

A0A3P8N5H5_BAX-01      gcagttgcaagaaacatctttgctgatggca---tcaactggggtcgagt
A0A3P8N5H5_BAX-02      gcagttgcaagaaacatctttgctgatggca---tcaactggggtcgagt
A0A3P8NNW3_BAX-01      agagtggcctctgagatcttttcagatggaatatttaactggggcagggt
A0A3P8NNH7_BAX-03      agagtggcctatgagatcttttcagatggaatatttaactggggcagggt
A0A3P8NNH7_BAX-01      agagtggcctatgagatcttttcagatggaatatttaactggggcagggt
                         *** **     * ****** * ***** *   * ********  * **

A0A3P8N5H5_BAX-01      agtggctctcttccatctggcctgtaaacttatacacaaggctattaccg
A0A3P8N5H5_BAX-02      agtggctctcttccatctggcctgtaaacttatacacaaggctattaccg
A0A3P8NNW3_BAX-01      ggttgcactgttctactttgcatgccgactcgttatcaaagtacgtgaaa
A0A3P8NNH7_BAX-03      ggttgcactgttctactttgcatgccgactcgttatcaaagctcttgtaa
A0A3P8NNH7_BAX-01      ggttgcactgttctactttgcatgccgactcgttatcaaagctcttgtaa
                        ** ** ** *** *  * ** **   ***  *   *** *    *    

A0A3P8N5H5_BAX-01      ccaatcacttagagaacatccaaatgatcatcagctgggtcctccaggtc
A0A3P8N5H5_BAX-02      ccaatcacttagagaacatccaaatgatcatcagctgggtcctccaggtc
A0A3P8NNW3_BAX-01      ct---------------------gctattgccgattccccctttgaat--
A0A3P8NNH7_BAX-03      ctcagattccggatattatcagaaccattatcagttggaccatagactat
A0A3P8NNH7_BAX-01      ctcagattccggatattatcagaaccattatcagttggaccatagactat
                       *                         **   *   *    * *  *    

A0A3P8N5H5_BAX-01      atcagggagcaggtctacagctggcttgtggcacaagggggctgggaggg
A0A3P8N5H5_BAX-02      atcagggagcaggtctacagctggcttgtggcacaagggggctgggaggg
A0A3P8NNW3_BAX-01      -----------------------------------------------gg-
A0A3P8NNH7_BAX-03      ctccgggaacatgtgatcaactggatcagggagcaaggtggctgggagg-
A0A3P8NNH7_BAX-01      ctccgggaacatgtgatcaactggatcagggagcaaggtggctgggagg-
                                                                      ** 

A0A3P8N5H5_BAX-01      ggtgatccgtggtttctctcgatggaggacagcagccatggtagcatcag
A0A3P8N5H5_BAX-02      ggtgatccgtggtttctctcgatggaggacagcagccatggtagcatcag
A0A3P8NNW3_BAX-01      --------gttttggatttt-------------------gtacgtgtttt
A0A3P8NNH7_BAX-03      --------gtattcgctcctactttggcacaccaacatggcagacggtcg
A0A3P8NNH7_BAX-01      --------gtattcgctcctactttggcacaccaacatggcagacggtcg
                               **  *   *                      *          

A0A3P8N5H5_BAX-01      tagtattggtggta------------gcctttgtttactaccggaa-agt
A0A3P8N5H5_BAX-02      tagtattggtggta------------gcctttgtttactaccggaa-agt
A0A3P8NNW3_BAX-01      gaattttgt-----------------acgtgttttggattttgcaacggt
A0A3P8NNH7_BAX-03      gagttttcttggcaggagtccttaccactgttcttgtcattcgcaa-gat
A0A3P8NNH7_BAX-01      gagttttcttggcaggagtccttaccactgttcttgtcattcgcaa-gat
                        * * **                    *   * **       * **   *

A0A3P8N5H5_BAX-01      acgataa
A0A3P8N5H5_BAX-02      acgataa
A0A3P8NNW3_BAX-01      ataa---
A0A3P8NNH7_BAX-03      gtga---
A0A3P8NNH7_BAX-01      gtga---
                          *   

© 1998-2020Legal notice