Dataset for CDS Unclassified of Organism Coregonus sp balchen

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|A0A6F9A7W6_uncBCLWAV-01 Putative BCL2 homolog found in water-living anamniote vertebrates gene OS=[Eukaryota] Coregonus sp. 'balchen' (length=597 residues).
atgggtcagtcagaggggctagagagcaggagtggcataaacagccctgaccccctggtacgagaagcctatctgatgtt
acatgactatatcaactatgtgatcgcagggcccgacggccacatagacccaccccctactgccacagcagcagccctgc
gccatgctggggacgagctgctcattaggttccccatcttcttcaggcgctggccacgcgtcttccaggatgtgactgag
gccacagcctgccccatgctcactgccatcctggatgagcactttgccaccaccacccccggggggcgccgacgagacct
ggcctggagtgcagtgctgtcggtgtatgtgctggctggccagatggccctgcactgccacgagaggggcatggggggaa
ttctgccccagcttaaggagtgtgtgggggtttacgtggagaggacaggctttgtgtcccgctttgggcagaagcaggac
ttggagggccaggtgaagaaggtatgttgctggactctactgctattggtcaccagtatcctgtcctatttcctgttgga
aacgaataatatcttcaacaacaccccgacctggtga
>gnl|bcl2dbcds|A0A6F9AE01_uncBCLWAV-01 Putative BCL2 homolog found in water-living anamniote vertebrates gene OS=[Eukaryota] Coregonus sp. 'balchen' (length=666 residues).
atgcctggagccggccctgcctcagagcagctcaaactgccaggaccactcctggatcagaatggagtcagtcagccagt
ggcgatggatcagtcagaggggctagagaacagaagttgcataaacagccctgaccccctggtacgagaggcctatctga
tggcccgaaggccacataggcccaccacccctacagccacatcagcagccctgcgccatgctggggacgagctgctcatt
aggttccccatcttcttcaggcgctggccacgcgtcttccaggacgtgactgaggcctcagcctgccccatgctcaccac
catcctagacaagcactttacccccaccacccccagggggcgccagcgagacctggcctggagcgctgtgcagtctgtgt
atgtgctggctggccagatggccctgcactgccacgagaggggcatggacggaatccttcctcagcttaaggagtgtgtg
gggggttatgtggagagggtcatctatccagagattagggacaagggtggatggacaggctttgtgtcccgctttgggca
gaagcaggacttggaggcccaggtgaagaaggtgtgttgctggactctactgctattggtcaccagtatcctgtcctatt
tcctgtggaaacgaagaatagcttaa
>gnl|bcl2dbcds|A0A6F9AJ23_uncBOK-01 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Coregonus sp. 'balchen' (length=351 residues).
atggatataggctatgtgttgatgatggatataggctatgtgttgatgatggatataggctatgtgttgatgatggatat
aggctatgtgttgatgatggatataggctatgtgttgatgatggatataggttatgtgttgatgatggatataggctatg
tgttgatgatggatataggttatgtgttgatgatggatataggttatgtgttgatgatggatatagctgatatcacgaag
tgcgtggtgaacacagaccccagtttccgctcccattggttgatgtctgctgcctgtgcctgtggacattacctgaaggc
catggtgttctacctgctccgggataagtga
© 1998-2023Legal notice