Dataset for CDS Unclassified of Organism Junco hyemalis

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C5JIM4_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Junco hyemalis (length=651 residues).
atggccccttccaaacctgagaatggacagagatggcctgacgtctgtccgtgtgtccctgcagaaggccgcgtggcaga
ggaggctgaggaggtgttccgcagctacgccttctaccggtaccagcaggagcgccaggagtgcggcgcggagctgccag
cctggcctgactccccctgtccccccagcacgggcagccaggtggggcagcgcctggccatcatcggggacgacatctac
cggcgctacgacgccgagttccgcaccatgctggagagcctgcagcccacccctcctggcgtgggctgggggcttcccct
gcaggagaagggaaggggaggtcaggtgtggtcagtgctgctggttaaacccacactctgtttgagcttcaccctccagc
cttcgagcttcccggggttattcctgtgttttctgcctgtctgcactgctcctatcattgtgccctcccaggcacaatgg
ggctcctctgggcagggattgctgctgccagctcctctctcccatcccaaagctgatttctgcagagcagggagttcagg
ctgggcgttccctgtcctgcccaagctgcagatgaaggatccctccctcttctccctctgcaggctgagcaggaccagcc
tggatttttag
>gnl|bcl2dbcds|A0A8C5JIM4_uncBAK1-02 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Junco hyemalis (length=627 residues).
atggcctcagggaatgaggggaatgaggaacgccggaggagccatggatggcctgacgtctgtccgtgtgtccctgcaga
aggccgcgtggcagaggaggctgaggaggtgttccgcagctacgccttctaccggtaccagcaggagcgccaggagtgcg
gcgcggagctgccgcccgaccccgagatcgaagcctggcctgactccccctgtccccccagcacgggcagccaggtgggg
cagcgcctggccatcatcggggacgacatctaccggcgctacgacgccgagttccgcaccatgctggagagcctgcagcc
cacccgccacaacgcctacgagaccttcaccaatattgcctccaggggaggtcaggtgtggtcagtgctgctggttaaac
ccacactctgtttgagcttcaccctccagccttcgagcttcccggggttattcctgtgttttctgcctgtctgcactgct
cctatcattgtgccctcccaggcacaatggggtccctcagaggatgccgtgcagaacctggacaatgtttacgtcaagta
cctgctggtggtggccgcggtggtggtgctggggcacctggtgctgcggcgcttcttcaccccctga
>gnl|bcl2dbcds|A0A8C5NNU9_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Junco hyemalis (length=411 residues).
atgtctcaaatcaggagaagccccaggcactttgtcctctccagctaccccaatggagcaccagaagaggaaacctacag
taacctccagacaattccagacaccacagagcaaatggagtttgatatcagctcagctactcaggttggccgtcagctgg
ccctgattggagatgaatttaacaggaggcaccacaggacattagaagaaacactgcttcacctggcacgagtggttgct
atcagtgttttccagacatggaatgttattaaaagtgttataagaagctgtggagatgtgagcagtaactggacaaagcg
gatcactggctatggaggctggacttgcaggcttcctgtcaggtgcctctgccagaagctggtgcctgcagccttgcttg
ttgctaattag
© 1998-2023Legal notice