Dataset for CDS BCL2A1 of organism Rhinolophus ferrumequinum

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A671FLY8_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BCL2A1 (length=738 residues).
atgccggctcaggagcccggttcctcctcagcccagctacgctcagaagtgcctgggagggaggctcctatcagtgatgt
aagcagaaattctaccggccccacatctcattgtgagtcacatcccgccaggcttggaactctagcttcagattttctca
gccccttcccggtgaacaagctcaagacgctgctctccagctggcagaagatgaccgactgtgagtttgggtacatccac
gcgctggcccaggactatctgacgtatgtcctgcaggtgccacagcctgggactggccccagcagaacctccagagtatt
gcaagatattgcctcttccgtccaaaaggaagtggaaaagaatttgaagccatgcttggacagcttcgatgtcatgtcca
tagatactgccaggacaatattcaaccaagtgatggaaaaggagtttgaagacggcgtcattaactggggaaggattgtg
accatattcgcatttgaaggtattctcatcaagaaactgcttcgggagcagatcaccccagatgtggatacttacaagga
catttcttactttgttgctgacttcataacggaacacacaggagaatggataaggcagaacggaggctgggaaaatggct
ttgtaaagaagtttggacccaaatctggctggctgacttttctggaagttacaggcaagatctgtgaaatgttctgtctt
ctgaagcaatactgttga
© 1998-2020Legal notice