Dataset for CDS BCL-2-like of organism Sarcophilus harrisii

[Download (right click)] [Alignment] [Repertoires]

11 sequence(s)

>gnl|bcl2dbcds|A0A7N4P3X2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2L1 (length=684 residues).
atgtctcacagtaaccgggagctggtggttgactttctttcttacaagctttcacagaagggatacaattggagtcagtt
tgaagatgagaacaggactgaggcctcagaagggacagagatacctagtactgtgaatggcagcccctcttggcaccctg
ctgacagccgtgcagtgagtggggccacaggacacagcagcagcctggatgcccatgagacaattcctgtagctgctgtg
aagcaagctttgagggaggcaggagatgaatttgaactccggtaccggcgggcattcagtgatctgacatcccagctcca
catcactccagggacggcttatcagagttttgagcaggtagtgaatgaactcttccgggatggggtgaactggggccgaa
ttgtggcattcttctccttcggaggggcattgtgtgtggaaagcgtggataaagagatggaagtcttggtagcacgcatc
acctcctggatggccacttacttggatgagcacctagacccatggatccaagaaaatggcggttgggacaccttcgtgga
gctttatgggaatgatgcagcagcagagagccggaagggccaggaacgcttcaacagatggctgctgactggcatgacag
tggctggtgtagtcctgctggggtccctgttcagccggaagtga
>gnl|bcl2dbcds|A0A7N4P3X2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2L1 (length=708 residues).
atgccagaaccagcatttttgcccaggatttcagaagagagctgtcaagcagatcccagactcagagagcagctttcaca
gaagggatacaattggagtcagtttgaagatgagaacaggactgaggcctcagaagggacagagatacctagtactgtga
atggcagcccctcttggcaccctgctgacagccgtgcagtgagtggggccacaggacacagcagcagcctggatgcccat
gagacaattcctgtagctgctgtgaagcaagctttgagggaggcaggagatgaatttgaactccggtaccggcgggcatt
cagtgatctgacatcccagctccacatcactccagggacggcttatcagagttttgagcaggtagtgaatgaactcttcc
gggatggggtgaactggggccgaattgtggcattcttctccttcggaggggcattgtgtgtggaaagcgtggataaagag
atggaagtcttggtagcacgcatcacctcctggatggccacttacttggatgagcacctagacccatggatccaagaaaa
tggcggttgggacaccttcgtggagctttatgggaatgatgcagcagcagagagccggaagggccaggaacgcttcaaca
gatggctgctgactggcatgacagtggctggtgtagtcctgctggggtccctgttcagccggaagtga
>gnl|bcl2dbcds|A0A7N4P573_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2A1 (length=606 residues).
atggcggctgcggcggctctcagcggatttaagcgcaacctgcgggccgagatgaagcagcggctgcgggcgctcagcgc
cgaggaacggctccgtcagtcccgcctgctgacagagaaggtgattgctcacagtaaatatcaagagtctcagagaattt
caatctttctaagcatgcaggatgaaattgagacagaagaaattatcaaggatatttttaaacaaggcaaaacatgtttt
atccctcgatacaaattcaatagtaactacatggatatggtcaggttattttcagctgaagaaattttttcacttcccaa
aacatcctggaacattcatcagcctggtgatgatgaagtacgggaggaggctttgtctaccgggggtctggatctcatct
tcatgccaggtcttggatttgaccaacagggaaaccgcctgggaagggggaagggatactatgacacttacctgaagaga
tgcttccaacaccaaaaaagaagaccttacacaattgctttggctttcaaagagcagatctgtgatgcagtgccagtggg
agaagatgatatgagaatagatgaagtgctctatgaagacaaataa
>gnl|bcl2dbcds|A0A7N4P573_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2A1 (length=906 residues).
atggctgattgtgaattccattatgttcacatgctagcccaggactacttgaagcatgttcaacaaatgccacgactggg
atcatgtctacataggacatctcaaatacttcaaaaagttgctttctctgtccaagaagaagttgaaaaggatatggaaa
cattcttgagcactttggacattacttctgtagattgtgccagaagaattttcaacagtgttatggaaaaggaatttgag
gatggcatcatcaactggggacggattgtcaccatatttgcttttgggggaattctcattaagaaacttctgagacacag
agctccactgactatggacactcatgaagaaatttctcattttattgctgagttcataatgaacaacatagcagaatgga
taagacaaaatggaggatgggtgattgctcacagtaaatatcaagagtctcagagaatttcaatctttctaagcatgcag
gatgaaattgagacagaagaaattatcaaggatatttttaaacaaggcaaaacatgttttatccctcgatacaaattcaa
tagtaactacatggatatggtcaggttattttcagctgaagaaattttttcacttcccaaaacatcctggaacattcatc
agcctggtgatgatgaagtacgggaggaggctttgtctaccgggggtctggatctcatcttcatgccaggtcttggattt
gaccaacagggaaaccgcctgggaagggggaagggatactatgacacttacctgaagagatgcttccaacaccaaaaaag
aagaccttacacaattgctttggctttcaaagagcagatctgtgatgcagtgccagtgggagaagatgatatgagaatag
atgaagtgctctatgaagacaaataa
>gnl|bcl2dbcds|A0A7N4P573_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2A1 (length=513 residues).
atggctgattgtgaattccattatgttcacatgctagcccaggactacttgaagcatgttcaacaaatgccacgactggg
atcatgtctacataggacatctcaaatacttcaaaaagttgctttctctgtccaagaagaagttgaaaaggatatggaaa
cattcttgagcactttggacattacttctgtagattgtgccagaagaattttcaacagtgttatggaaaaggaatttgag
gatggcatcatcaactggggacggattgtcaccatatttgcttttgggggaattctcattaagaaacttctgagacacag
agctccactgactatggacactcatgaagaaatttctcattttattgctgagttcataatgaacaacatagcagaatgga
taagacaaaatggaggatggggggtctggatctcatcttcatgccaggtcttggatttgaccaacagggaaaccgcctgg
gaagggggaagggatactatgacacttacctga
>gnl|bcl2dbcds|A0A7N4P573_BCL2A1-04 BCL2-related protein A1 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2A1 (length=519 residues).
atggctgattgtgaattccattatgttcacatgctagcccaggactacttgaagcatgttcaacaaatgccacgactggg
atcatgtctacataggacatctcaaatacttcaaaaagttgctttctctgtccaagaagaagttgaaaaggatatggaaa
cattcttgagcactttggacattacttctgtagattgtgccagaagaattttcaacagtgttatggaaaaggaatttgag
gatggcatcatcaactggggacggattgtcaccatatttgcttttgggggaattctcattaagaaacttctgagacacag
agctccactgactatggacactcatgaagaaatttctcattttattgctgagttcataatgaacaacatagcagaatgga
taagacaaaatggaggatgggaaaatggcttcataaagaactttgaacccaatatggtatggccaaacttcacagatatt
tcaacaaagatctggaatgtattttcctttctgaagtaa
>gnl|bcl2dbcds|A0A7N4P7T7_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2L10 (length=561 residues).
atggagaccgaggatgcccttcgggaggagacgcggcggctggtgagcgactacctggagcactgctgccgtgcggaggg
ctgccaggaacgggcgccctccactccggccgcggccacgatgcgcgcggtggcccaggagctccgccggacttaccgcg
acttcttcgagtgcgccaagagtcagctgctcgaccagccgcccgagcgggtcatccccgaagtggcggagatgatggac
cagggcggcttcaactggggccgggtggcggtgctggtggtgtttgccggggcgatgctggagatggaggagcaggagaa
gcagcagcgagggcggctccggagcgagatgagccggcgcctggccgaggagctctgccactatctggtggagaagaagg
gcgcgtggctgcgggagaacggaggctggactggctttcaccaccacttcacccagaagcagcctcccccacaaagtgat
ccaaagagtaccctgtgctgtatagtggccgccgcaggatttggactggtgggattagctcttctattagccgtacgata
a
>gnl|bcl2dbcds|A0A7N4PQN7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL-2 (length=768 residues).
atggctcaccctggaagaagaggatatgataaccgggaaatagtgatgaaatacattcattataagctatcacagagagg
gtacgagtgggatgctggaaatctgaggacaccagcctctccaagtcttcctcctgttgttgcttctgcccctgctgttg
gaatcttctctaaccagccaagacatacacctctgcctgctgcaccccaggacttggccacttctactactgctgctgct
agaaactcacctttgcctcctcctcctgctgttgctgctgctactgttgctgctggaccagctgtcagtccagtgccacc
tgtggtccacctgactcttcgtcaagctggagatgatttctctcgaagatatcgaagagatttcgatgaaatgtcaggtc
agctgcacctgacccctgttactgctaggggacgctttgccacagtagtggaagagctgttcagggatggggtgaactgg
gggcggattgtggccttctttgaatttggtggtgttatgtgtgtggagagcgtcaaccgggagatgtcgcctctggtgga
cagcatagccctgtggatgactgagtacctgaaccggcacctgcacaactggatccaggataacggaggatgggatgcct
ttgtggaattatatggcaacagcatgagacctttgttcgatttctcctggctgtctctgaagactctcctcagcctggct
ctggtgggagcttgcatcactcttggtgcctacctaggacacaagtga
>gnl|bcl2dbcds|A0A7N4PRP1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sarcophilus harrisii GN=MCL-1 (length=1152 residues).
atgttaggcccttttaagaaaaacgccgtcatcggcctcaatctgtattgcgggggggccggcttgggcgccggcagcgg
cgccagcgcttccccgtccggcgggcgcctgctgactaatggcaaaggaacggcggtggagagttcgccgccgcggctgg
acggaggggaagtgggagcgagcaccacgacgacggcagcggcggcggtagggttaaggggcggaagcggcggcgcgaat
ccccccgaccccgtggtgccgggcgtccggggggtcgcgcggcccgcgcccattggcgcggaggctcgcgacgtcaccgc
cccgccgagaccgttctttttcgcgccgggcggccgctgctcgccccccgccgaggtggccgatggagccgcggacgcca
tcctatcccccgaggacgagctggacggttacgagcccgagctccccgggaagcggcccgctcgcctggccatgctgccc
ttggccagagagggtggggacacatcgagcaatgcccgcggctcactgccctcaacgccgcccccggccgaggaggacga
ggacgaggaggaggatgagttgtacgggcagtccttggagttgataacccgatacctccgcgagcaggcggtcggcacca
aggacaccaagcccctacgcagtgggaaggcactggagaccctgcggcgcgtgggagacggtgtccagaggaaccacgag
acggctttccaaggtatgcttcgcaaactggatatcaagaacgaagaggacattaaggccgtgtctcgcgtggtaactca
tgtgttcagtgacggggtgacgaattggggcagaattgtgactctcatttctttcggggcctttgtggcaaagcacttga
agagcataaaccaggaaagttgcatagacccgctagcagaaagcataacagatgtcctggttaaatcgaaaagggactgg
ctgatgaagcagaagggctgggagatgcccctgtgtgacctcagatggtccctgcaacccagcccttctccagtaatgaa
ccttcttgtctccgagtattcaaaaggtagtggactgggtgtcttatgtgagcaaggttggcaatatctggtgctggtgc
ccttttggttagctttgctaaaggtgttttga
>gnl|bcl2dbcds|A0A7N4PRP1_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sarcophilus harrisii GN=MCL-1 (length=1080 residues).
atgttaggcccttttaagaaaaacgccgtcatcggcctcaatctgtattgcgggggggccggcttgggcgccggcagcgg
cgccagcgcttccccgtccggcgggcgcctgctgactaatggcaaaggaacggcggtggagagttcgccgccgcggctgg
acggaggggaagtgggagcgagcgcggcggtagggttaaggggcggaagcggcggcgcgaatccccccgaccccgtggtg
ccgggcgtccggggggtcgcgcggcccgcgcccattggcgcggaggctcgcgacgtcaccgccccgccgagaccgttctt
tttcgcgccgggcggccgctgctcgccccccgccgaggtggccgatggagccgcggacgccatcctatcccccgaggacg
agctggacggttacgagcccgagctccccgggaagcggcccgctcgcctggccatgctgcccttggccagagagggtggg
gacacatcgagcaatgcccgcggctcactgccctcaacgccgcccccggccgaggaggacgaggacgaggaggaggatga
gttgtacgggcagtccttggagttgataacccgatacctccgcgagcaggcggtcggcaccaaggacaccaagcccctac
gcagtgggaaggcactggagaccctgcggcgcgtgggagacggtgtccagaggaaccacgagacggctttccaaggtatg
cttcgcaaactggatatcaagaacgaagaggacattaaggccgtgtctcgcgtggtaactcatgtgttcagtgacggggt
gacgaattggggcagaattgtgactctcatttctttcggggcctttgtggcaaagcacttgaagagcataaaccaggaaa
gttgcatagacccgctagcagaaagcataacagatgtcctggttaaatcgaaaagggactggctgatgaagcagaagggc
tgggaggggtttgtggaattctttcatgtagaggacctagaaggtggcatcagaaatgtgctgctcgcctttgccggtgt
tgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A7N4PRP1_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sarcophilus harrisii GN=MCL-1 (length=1098 residues).
atgttaggcccttttaagaaaaacgccgtcatcggcctcaatctgtattgcgggggggccggcttgggcgccggcagcgg
cgccagcgcttccccgtccggcgggcgcctgctgactaatggcaaaggaacggcggtggagagttcgccgccgcggctgg
acggaggggaagtgggagcgagcaccacgacgacggcagcggcggcggtagggttaaggggcggaagcggcggcgcgaat
ccccccgaccccgtggtgccgggcgtccggggggtcgcgcggcccgcgcccattggcgcggaggctcgcgacgtcaccgc
cccgccgagaccgttctttttcgcgccgggcggccgctgctcgccccccgccgaggtggccgatggagccgcggacgcca
tcctatcccccgaggacgagctggacggttacgagcccgagctccccgggaagcggcccgctcgcctggccatgctgccc
ttggccagagagggtggggacacatcgagcaatgcccgcggctcactgccctcaacgccgcccccggccgaggaggacga
ggacgaggaggaggatgagttgtacgggcagtccttggagttgataacccgatacctccgcgagcaggcggtcggcacca
aggacaccaagcccctacgcagtgggaaggcactggagaccctgcggcgcgtgggagacggtgtccagaggaaccacgag
acggctttccaaggtatgcttcgcaaactggatatcaagaacgaagaggacattaaggccgtgtctcgcgtggtaactca
tgtgttcagtgacggggtgacgaattggggcagaattgtgactctcatttctttcggggcctttgtggcaaagcacttga
agagcataaaccaggaaagttgcatagacccgctagcagaaagcataacagatgtcctggttaaatcgaaaagggactgg
ctgatgaagcagaagggctgggaggggtttgtggaattctttcatgtagaggacctagaaggtggcatcagaaatgtgct
gctcgcctttgccggtgttgctggagtaggagctggtttggcatatctaataagatag
© 1998-2022Legal notice