Dataset for CDS BCL-2-like of organism Sarcophilus harrisii

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G3WSP8_BCL2A1-01      --------------------------------------------------
G3WBC5_MCL1-01        --------gacgtcaccgccccgccgagaccgttctttttcgcgccgggc
G3WZW9_BCL2-02        ccatttggctgctctccttggtgttcactgctctctcctttgggaataat
G3WZW9_BCL2-01        ------------------------------------------------at
G3WKX6_BCL2L1-01      ------------------------------------------------at
G3WPT1_BCL2L2-01      catagctcaagccccattttcttctctctgccttttatagccagccagat
G3WPT1_BCL2L2-02      ------------------------------------------------at

G3WSP8_BCL2A1-01      ------------------------------------atggctga-----t
G3WBC5_MCL1-01        ggccgctgctcgccccccgccga------------ggtggccgatggagc
G3WZW9_BCL2-02        ----------ggctcaccctggaagaagaggatatgataaccgg-gaaat
G3WZW9_BCL2-01        ----------ggctcaccctggaagaagaggatatgataaccgg-gaaat
G3WKX6_BCL2L1-01      ----------gtctca----ca-------------g-taaccgg-gagct
G3WPT1_BCL2L2-01      ggcgactccagcctcagcccca-------------gatactcga-gccct
G3WPT1_BCL2L2-02      ggcgactccagcctcagcccca-------------gatactcga-gccct
                                                           *    *       

G3WSP8_BCL2A1-01      tgtgaattccattatgt-tcacatgctagcccaggactacttgaagc---
G3WBC5_MCL1-01        cgcggacgccatcctatcccccgaggacgagctggacggttacgagc---
G3WZW9_BCL2-02        agtgatgaaatacattcattataagctatcacagagagggtacga-----
G3WZW9_BCL2-01        agtgatgaaatacattcattataagctatcacagagagggtacgagtggg
G3WKX6_BCL2L1-01      ggtggttgactttctttcttacaagctttcacagaagggatacaa-----
G3WPT1_BCL2L2-01      ggtggcagattttgtgggttataagctaaggcagaagggctatgc-----
G3WPT1_BCL2L2-02      ggtggcagattttgtgggttataagctaaggcagaagggctatgc-----
                       * *          *         *      * *      *         

G3WSP8_BCL2A1-01      --------------------------------------------------
G3WBC5_MCL1-01        --------------------------------------------------
G3WZW9_BCL2-02        --------------------------------------------------
G3WZW9_BCL2-01        atgctggaaatctgaggacaccagcctctccaagtcttcctcctgttgtt
G3WKX6_BCL2L1-01      --------------------------------------------------
G3WPT1_BCL2L2-01      --------------------------------------------------
G3WPT1_BCL2L2-02      --------------------------------------------------

G3WSP8_BCL2A1-01      -----------------------------------atgttcaacaaatgc
G3WBC5_MCL1-01        --------------------------ccgagctccccgggaagcggcccg
G3WZW9_BCL2-02        --------------------------------------------------
G3WZW9_BCL2-01        gcttctgcccctgctgttggaatcttctctaaccagccaagacatacacc
G3WKX6_BCL2L1-01      --------------------------ttggagtcagtttgaagatgagaa
G3WPT1_BCL2L2-01      --------------------------ctg---------------------
G3WPT1_BCL2L2-02      --------------------------ctg---------------------

G3WSP8_BCL2A1-01      cacgactgg-------gatcatgtctacataggac------atctcaaat
G3WBC5_MCL1-01        ctcgcctggccatgctgcccttggccagagagggtggggacacatcgagc
G3WZW9_BCL2-02        --------------------------------------------------
G3WZW9_BCL2-01        tctgcctgc-------------tgcaccccaggacttggccacttctact
G3WKX6_BCL2L1-01      caggactga-------------ggcctcagaagggacagagatacctagt
G3WPT1_BCL2L2-01      tggaactgg----------------cccaggagag------------ggc
G3WPT1_BCL2L2-02      tggaactgg----------------cccaggagag------------ggc

G3WSP8_BCL2A1-01      acttcaaaaagttg-------ctttctctgtcc-----------------
G3WBC5_MCL1-01        aatgcccgcggctcactgccctcaacgccgcccccggccgaggaggacga
G3WZW9_BCL2-02        --------------------------------------------------
G3WZW9_BCL2-01        actgctgctgctagaaactcacctttgcctcctcctcctgc---------
G3WKX6_BCL2L1-01      actgtgaatggcag------cccctcttggcaccctgctga---------
G3WPT1_BCL2L2-01      cctacaaatg--ag------cctct----gcacc----------------
G3WPT1_BCL2L2-02      cctacaaatg--ag------cctct----gcacc----------------

G3WSP8_BCL2A1-01      --------------------------------------------------
G3WBC5_MCL1-01        ggacgaggaggaggatgagttgtacgggcagtccttggagttgataaccc
G3WZW9_BCL2-02        -----------------------------------tgttg--------ct
G3WZW9_BCL2-01        --------------------tgttgctgctgctactgttg--------ct
G3WKX6_BCL2L1-01      --------------------cagccgtgcagtgagtgggg--------cc
G3WPT1_BCL2L2-01      -------------------------------------ggg--------cc
G3WPT1_BCL2L2-02      -------------------------------------ggg--------cc

G3WSP8_BCL2A1-01      --------------------------------------------------
G3WBC5_MCL1-01        gatacctccgcgagcaggcggtcggcaccaaggacaccaagcccctacgc
G3WZW9_BCL2-02        gctggaccagctgtcagtccagtgccac------------------ctgt
G3WZW9_BCL2-01        gctggaccagctgtcagtccagtgccac------------------ctgt
G3WKX6_BCL2L1-01      acaggacacagcagcagcctggatgcccatgagacaattcctgtagctgc
G3WPT1_BCL2L2-01      a-------------------------------------------------
G3WPT1_BCL2L2-02      a-------------------------------------------------

G3WSP8_BCL2A1-01      ----------------------------------aagaagaagttgaaa-
G3WBC5_MCL1-01        agtgggaaggcactggagaccctgcggcgcgtgggagacggtgtccagag
G3WZW9_BCL2-02        ggtcca--------cctgactcttcgtcaagctggagatgatttctctcg
G3WZW9_BCL2-01        ggtcca--------cctgactcttcgtcaagctggagatgatttctctcg
G3WKX6_BCL2L1-01      tgtgaa--------gcaagctttgagggaggcaggagatgaatttgaact
G3WPT1_BCL2L2-01      ----------------------tgcgagccgctggagatgagtttgagtc
G3WPT1_BCL2L2-02      ----------------------tgcgagccgctggagatgagtttgagtc
                                                         *** *   *      

G3WSP8_BCL2A1-01      aggatatggaaacattcttgagcactt-----------tggacat----t
G3WBC5_MCL1-01        gaaccacgagacggctttccaaggtatgcttcgcaaactggatatcaaga
G3WZW9_BCL2-02        aagatatcgaagagatttcgatgaaatgtcaggtcagctgcacct----g
G3WZW9_BCL2-01        aagatatcgaagagatttcgatgaaatgtcaggtcagctgcacct----g
G3WKX6_BCL2L1-01      ccggtaccggcgggcattcagtgatctgacatcccagctccacat----c
G3WPT1_BCL2L2-01      ccgtttccgacgcacattttctgatctggctgctcagttgcatgt----g
G3WPT1_BCL2L2-02      ccgtttccgacgcacattttctgatctggctgctcagttgcatgt----g
                                       *        *           *  *  *     

G3WSP8_BCL2A1-01      acttctgtagattgtgccagaagaattttcaacagtgttatggaaaagga
G3WBC5_MCL1-01        acgaag---aggacattaaggccgtgtctcgc----gtggtaactcatgt
G3WZW9_BCL2-02        acccct---gttactgctaggggacgctttgccacagtagtggaagagct
G3WZW9_BCL2-01        acccct---gttactgctaggggacgctttgccacagtagtggaagagct
G3WKX6_BCL2L1-01      actcca---gggacggcttatcagagttttgagcaggtagtgaatgaact
G3WPT1_BCL2L2-01      actcct---ggctcagcccagcagcgctttacccaggtctcagatgagct
G3WPT1_BCL2L2-02      actcct---ggctcagcccagcagcgctttacccaggtctcagatgagct
                      **                          *       **        *   

G3WSP8_BCL2A1-01      atttgaggatggcatcatcaactggggacggattgtcaccatatttgctt
G3WBC5_MCL1-01        gttcagtgacggggtgacgaattggggcagaattgtgactctcatttctt
G3WZW9_BCL2-02        gttcagggatggggt---gaactgggggcggattgtggccttctttgaat
G3WZW9_BCL2-01        gttcagggatggggt---gaactgggggcggattgtggccttctttgaat
G3WKX6_BCL2L1-01      cttccgggatggggt---gaactggggccgaattgtggcattcttctcct
G3WPT1_BCL2L2-01      cttccaggggggggc---caactggggccgtcttgtggcattcttcgtct
G3WPT1_BCL2L2-02      cttccaggggggggc---caactggggccgtcttgtggcattcttcgtct
                       **    *  **       ** *****  *  ****  *  *  *    *

G3WSP8_BCL2A1-01      ttggg--------ggaattctcattaagaaacttctgagacacagagctc
G3WBC5_MCL1-01        tcggggcctttgtggcaaagcacttgaagagcata---aaccaggaaagt
G3WZW9_BCL2-02        ttggtgg------tgttatgtgtgtggagagcgtc---aaccgggag---
G3WZW9_BCL2-01        ttggtgg------tgttatgtgtgtggagagcgtc---aaccgggag---
G3WKX6_BCL2L1-01      tcggagg------ggcattgtgtgtggaaagcgtg---gataaagag---
G3WPT1_BCL2L2-01      ttggggc------agcgctctgtgcagagagcgtc---aacaaagag---
G3WPT1_BCL2L2-02      ttggggc------agcgctctgtgcagagagcgtc---aacaaagag---
                      * **          *              * * *     *    **    

G3WSP8_BCL2A1-01      cactgactatggacactcatgaagaa---atttctcattttattgctgag
G3WBC5_MCL1-01        tgc-----atagacccgctagcagaaagcataaca--------gatgtcc
G3WZW9_BCL2-02        --------atgtcgcctctggtggacagcatagccctgtggatgactgag
G3WZW9_BCL2-01        --------atgtcgcctctggtggacagcatagccctgtggatgactgag
G3WKX6_BCL2L1-01      --------atggaagtcttggtagcacgcatcacctcctggatggccact
G3WPT1_BCL2L2-01      --------atggagccactggtgggacaagaaaaaagatatggggtgcac
G3WPT1_BCL2L2-02      --------atggagccactggtgggacaggttcaggattggatggtgacc
                              **          *  *                          

G3WSP8_BCL2A1-01      ttcataatgaacaacatagcagaatggat--aagacaaaatggaggatgg
G3WBC5_MCL1-01        tggttaaatcgaaaagggactggctg------atgaagcagaagggctgg
G3WZW9_BCL2-02        tacctgaaccggcacctgcacaactggatccaggata--acggaggatgg
G3WZW9_BCL2-01        tacctgaaccggcacctgcacaactggatccaggata--acggaggatgg
G3WKX6_BCL2L1-01      tacttggatgagcacctagacccatggatccaagaaa--atggcggttgg
G3WPT1_BCL2L2-01      ttgaagcagggaattttagcaaggtatttaccaagcaaggctggagct--
G3WPT1_BCL2L2-02      tacctagagacacagctggcagactggatccacagca--gcgggggctgg
                      *                       *           *        * *  

G3WSP8_BCL2A1-01      gaaaatggcttcataaagaactttgaacccaatat---------------
G3WBC5_MCL1-01        g---aggggtttgtggaattcttt--------------------------
G3WZW9_BCL2-02        g-------------------------------------------------
G3WZW9_BCL2-01        g---gtac---------------------------------caaagcaat
G3WKX6_BCL2L1-01      g---acaccttcgtggagctttatgggaatgatgc------agcagcaga
G3WPT1_BCL2L2-01      g---cggaattcacggctctgtacggggatggggccctggaggaggcaag
G3WPT1_BCL2L2-02      g---cggaattcacggctctgtacggggatggggccctggaggaggcaag

G3WSP8_BCL2A1-01      -ggtatggccaaacttcacagatatttca------acaaagatctg----
G3WBC5_MCL1-01        -catgtagaggacctagaaggtggcatca---------gaaatgtgctgc
G3WZW9_BCL2-02        -----ta--gg-----------tgtttcggct------------------
G3WZW9_BCL2-01        ttgcatg--ggcaccagtggtccatttcaggtaagttaa-----------
G3WKX6_BCL2L1-01      gagccggaagggccaggaac---gcttca------acagatggctgctga
G3WPT1_BCL2L2-01      gcgtctg-cgggaggggaactgggcctcagtgcgtacag-----tgctaa
G3WPT1_BCL2L2-02      gcgtctg-cgggaggggaactgggcctcagtgcgtacag-----tgctaa

G3WSP8_BCL2A1-01      ----------------------------------gaatgtattttccttt
G3WBC5_MCL1-01        tcgcctttgccggtgttgctggagtaggagctggtttggcatatctaata
G3WZW9_BCL2-02        --------------------------------------------------
G3WZW9_BCL2-01        --------------------------------------------------
G3WKX6_BCL2L1-01      ctgg---catgacagtggctggtgtagtcctgctggggtccctgttcagc
G3WPT1_BCL2L2-01      caggggctgtggcactgggggctctggtgactgtgggggccttctttgcc
G3WPT1_BCL2L2-02      caggggctgtggcactgggggctctggtgactgtgggggccttctttgcc

G3WSP8_BCL2A1-01      ctgaagtaa
G3WBC5_MCL1-01        agatag---
G3WZW9_BCL2-02        ---------
G3WZW9_BCL2-01        ---------
G3WKX6_BCL2L1-01      cggaagtga
G3WPT1_BCL2L2-01      agcaagtga
G3WPT1_BCL2L2-02      agcaagtga

© 1998-2020Legal notice