Dataset for CDS BCL-2-like of organism Sarcophilus harrisii

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A7N4P573_BCL2A1-      atggcggctgcggc------------------------------------
A0A7N4P573_BCL2A1-      atggctgat--tgt------------------------------------
A0A7N4P573_BCL2A1-      atggctgat--tgt------------------------------------
A0A7N4P573_BCL2A1-      atggctgat--tgt------------------------------------
A0A7N4P7T7_BCL2L10      atg-gagacc-------------------------ga-------------
A0A7N4PRP1_MCL1-01      atgttaggccc-----------------ttttaagaa-------------
A0A7N4PRP1_MCL1-02      atgttaggccc-----------------ttttaagaa-------------
A0A7N4PRP1_MCL1-03      atgttaggccc-----------------ttttaagaa-------------
A0A7N4PQN7_BCL2-01      atggctcaccctgga-----agaagaggatatgataaccgggaaatagtg
A0A7N4P3X2_BCL2L1-      atgtc-----------------------tcacagtaaccgggagctggtg
A0A7N4P3X2_BCL2L1-      atgccagaaccagcatttttgcccaggatttcagaa---gagagctgtca
                        ***                                               

A0A7N4P573_BCL2A1-      ---ggctctcagcgg-----------------------------atttaa
A0A7N4P573_BCL2A1-      ---gaattccattat-----------------------------gttcac
A0A7N4P573_BCL2A1-      ---gaattccattat-----------------------------gttcac
A0A7N4P573_BCL2A1-      ---gaattccattat-----------------------------gttcac
A0A7N4P7T7_BCL2L10      ---ggatgccct------------------tcgggaggagac--------
A0A7N4PRP1_MCL1-01      ---aaacgccgtcatcggcctcaatctgtattgcgggggggccggcttgg
A0A7N4PRP1_MCL1-02      ---aaacgccgtcatcggcctcaatctgtattgcgggggggccggcttgg
A0A7N4PRP1_MCL1-03      ---aaacgccgtcatcggcctcaatctgtattgcgggggggccggcttgg
A0A7N4PQN7_BCL2-01      atgaaatacattcattata----agctatcacagagagggtacgagtggg
A0A7N4P3X2_BCL2L1-      gttgactttctttcttaca----agctttcacagaagggatacaattgga
A0A7N4P3X2_BCL2L1-      agcagatcccagactcagagagcagctttcacagaagggatacaattgga
                                                                          

A0A7N4P573_BCL2A1-      gcgcaacctg----------------------------------------
A0A7N4P573_BCL2A1-      atgctagcc-----------------------------------------
A0A7N4P573_BCL2A1-      atgctagcc-----------------------------------------
A0A7N4P573_BCL2A1-      atgctagcc-----------------------------------------
A0A7N4P7T7_BCL2L10      ------gcggcgg-----------------ctggtgagcgactacc----
A0A7N4PRP1_MCL1-01      gcgccggcagcggcgccagcgcttccccgtccggcgggcgcctgctgact
A0A7N4PRP1_MCL1-02      gcgccggcagcggcgccagcgcttccccgtccggcgggcgcctgctgact
A0A7N4PRP1_MCL1-03      gcgccggcagcggcgccagcgcttccccgtccggcgggcgcctgctgact
A0A7N4PQN7_BCL2-01      atgctggaaa--------------------tctgaggacaccagcc----
A0A7N4P3X2_BCL2L1-      gt-----cag--------------------tttgaaga------------
A0A7N4P3X2_BCL2L1-      gt-----cag--------------------tttgaaga------------
                                                                          

A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P7T7_BCL2L10      -------------------tggag-------cactgctgccgtgcgga--
A0A7N4PRP1_MCL1-01      aatggcaaaggaacggcggtggagagttcgccgccgcggctggacgga--
A0A7N4PRP1_MCL1-02      aatggcaaaggaacggcggtggagagttcgccgccgcggctggacgga--
A0A7N4PRP1_MCL1-03      aatggcaaaggaacggcggtggagagttcgccgccgcggctggacgga--
A0A7N4PQN7_BCL2-01      --tctccaagtcttcctcctgttgttgcttctgcccctgctgttggaatc
A0A7N4P3X2_BCL2L1-      ------------------------------------------tgagaa--
A0A7N4P3X2_BCL2L1-      ------------------------------------------tgagaa--
                                                                          

A0A7N4P573_BCL2A1-      -------------cgggc--------------------------------
A0A7N4P573_BCL2A1-      -------------cagga--------------------------------
A0A7N4P573_BCL2A1-      -------------cagga--------------------------------
A0A7N4P573_BCL2A1-      -------------cagga--------------------------------
A0A7N4P7T7_BCL2L10      ------gggctgccaggaacgggcg-------------------------
A0A7N4PRP1_MCL1-01      ------ggggaagtgggagcgagcaccacgacgacggcagcggcggcggt
A0A7N4PRP1_MCL1-02      ------ggggaagtgggagcgagc------------------gcggcggt
A0A7N4PRP1_MCL1-03      ------ggggaagtgggagcgagcaccacgacgacggcagcggcggcggt
A0A7N4PQN7_BCL2-01      ttctctaaccagccaaga--------------------------------
A0A7N4P3X2_BCL2L1-      -------------cagga--------------------------------
A0A7N4P3X2_BCL2L1-      -------------cagga--------------------------------
                                        *                                 

A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P7T7_BCL2L10      --------------------------------ccctccactcc-------
A0A7N4PRP1_MCL1-01      agggttaaggggcggaagcggcggcgcgaatccccccgaccccgtggtgc
A0A7N4PRP1_MCL1-02      agggttaaggggcggaagcggcggcgcgaatccccccgaccccgtggtgc
A0A7N4PRP1_MCL1-03      agggttaaggggcggaagcggcggcgcgaatccccccgaccccgtggtgc
A0A7N4PQN7_BCL2-01      ---------------------------------catacacctc----tgc
A0A7N4P3X2_BCL2L1-      ---------------------------------ctgaggcctc----ag-
A0A7N4P3X2_BCL2L1-      ---------------------------------ctgaggcctc----ag-
                                                                          

A0A7N4P573_BCL2A1-      -----------cgagatgaagca---------------gcggctgcg---
A0A7N4P573_BCL2A1-      -----------ctacttgaagcatgttcaacaaatgccacgactggg---
A0A7N4P573_BCL2A1-      -----------ctacttgaagcatgttcaacaaatgccacgactggg---
A0A7N4P573_BCL2A1-      -----------ctacttgaagcatgttcaacaaatgccacgactggg---
A0A7N4P7T7_BCL2L10      -------------ggccgcg------gccacgatgcgcgc----ggtggc
A0A7N4PRP1_MCL1-01      cgggcgtccggggggtcgcgcggcccgcgcccattggcgc----ggaggc
A0A7N4PRP1_MCL1-02      cgggcgtccggggggtcgcgcggcccgcgcccattggcgc----ggaggc
A0A7N4PRP1_MCL1-03      cgggcgtccggggggtcgcgcggcccgcgcccattggcgc----ggaggc
A0A7N4PQN7_BCL2-01      ctgctgcaccccaggacttggccacttctactactgctgctgctagaaac
A0A7N4P3X2_BCL2L1-      ----------aagggacagagatac-----ctagtactgtgaatggcagc
A0A7N4P3X2_BCL2L1-      ----------aagggacagagatac-----ctagtactgtgaatggcagc
                                                                          

A0A7N4P573_BCL2A1-      ----------------------ggcg----------------ctca---g
A0A7N4P573_BCL2A1-      ----------------------atcatgtctacataggacatctcaaata
A0A7N4P573_BCL2A1-      ----------------------atcatgtctacataggacatctcaaata
A0A7N4P573_BCL2A1-      ----------------------atcatgtctacataggacatctcaaata
A0A7N4P7T7_BCL2L10      ccagga-------gctcc----gccggacttaccgcgacttcttcgagtg
A0A7N4PRP1_MCL1-01      tcgcgacgtcaccgcccc----gccgag---accgtt-ctttttc----g
A0A7N4PRP1_MCL1-02      tcgcgacgtcaccgcccc----gccgag---accgtt-ctttttc----g
A0A7N4PRP1_MCL1-03      tcgcgacgtcaccgcccc----gccgag---accgtt-ctttttc----g
A0A7N4PQN7_BCL2-01      tcacctttgcctcctcct-cctgctgttgctgctgctactgtt------g
A0A7N4P3X2_BCL2L1-      ccctcttggcaccctgctgacagccg----tgcagtgagtggg------g
A0A7N4P3X2_BCL2L1-      ccctcttggcaccctgctgacagccg----tgcagtgagtggg------g
                                                                          

A0A7N4P573_BCL2A1-      cgccgaggaacggctccgtcagtcccgcctgctgacagagaaggtga---
A0A7N4P573_BCL2A1-      cttcaaaaagttgctttctctgtcc---------aagaagaagttgaaaa
A0A7N4P573_BCL2A1-      cttcaaaaagttgctttctctgtcc---------aagaagaagttgaaaa
A0A7N4P573_BCL2A1-      cttcaaaaagttgctttctctgtcc---------aagaagaagttgaaaa
A0A7N4P7T7_BCL2L10      cgccaagagtcagct--gctcgaccagccgcccgagcgggtcatccccga
A0A7N4PRP1_MCL1-01      cgccgggcggccgct--gctcgcccc-ccgccgaggtggccgat----gg
A0A7N4PRP1_MCL1-02      cgccgggcggccgct--gctcgcccc-ccgccgaggtggccgat----gg
A0A7N4PRP1_MCL1-03      cgccgggcggccgct--gctcgcccc-ccgccgaggtggccgat----gg
A0A7N4PQN7_BCL2-01      ctgctggac-cagct--gtcagtccag-tgcc------------------
A0A7N4P3X2_BCL2L1-      ccacaggacacagca--g-cagcctggatgcccatg-agacaattcctgt
A0A7N4P3X2_BCL2L1-      ccacaggacacagca--g-cagcctggatgcccatg-agacaattcctgt
                        *  *        **       * *                          

A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      ggatatgg------------------------------------------
A0A7N4P573_BCL2A1-      ggatatgg------------------------------------------
A0A7N4P573_BCL2A1-      ggatatgg------------------------------------------
A0A7N4P7T7_BCL2L10      agtggcgga----------------gatgatggaccagggcggcttcaa-
A0A7N4PRP1_MCL1-01      agccgcggacgccatcctatcccccgaggacgagct-ggacggttacgag
A0A7N4PRP1_MCL1-02      agccgcggacgccatcctatcccccgaggacgagct-ggacggttacgag
A0A7N4PRP1_MCL1-03      agccgcggacgccatcctatcccccgaggacgagct-ggacggttacgag
A0A7N4PQN7_BCL2-01      acctgtgg-------------------------------------tcca-
A0A7N4P3X2_BCL2L1-      agctgctg-------------------------------------tgaa-
A0A7N4P3X2_BCL2L1-      agctgctg-------------------------------------tgaa-
                                                                          

A0A7N4P573_BCL2A1-      ---------------------------------------------ttgct
A0A7N4P573_BCL2A1-      -------------------------------------aaacattcttgag
A0A7N4P573_BCL2A1-      -------------------------------------aaacattcttgag
A0A7N4P573_BCL2A1-      -------------------------------------aaacattcttgag
A0A7N4P7T7_BCL2L10      -ctggg---gccgggtggcggtgc-------------tggtggtgtttgc
A0A7N4PRP1_MCL1-01      cccgagctccccgggaagcggcccgctcgcctggccatgctgcccttggc
A0A7N4PRP1_MCL1-02      cccgagctccccgggaagcggcccgctcgcctggccatgctgcccttggc
A0A7N4PRP1_MCL1-03      cccgagctccccgggaagcggcccgctcgcctggccatgctgcccttggc
A0A7N4PQN7_BCL2-01      -cctgactcttcgtcaagctgg---------------agatgatttctct
A0A7N4P3X2_BCL2L1-      -gcaagctttgagggaggcagg---------------agatgaatttgaa
A0A7N4P3X2_BCL2L1-      -gcaagctttgagggaggcagg---------------agatgaatttgaa
                                                                     *    

A0A7N4P573_BCL2A1-      ca------------------------------------------------
A0A7N4P573_BCL2A1-      ca------------------------------------------------
A0A7N4P573_BCL2A1-      ca------------------------------------------------
A0A7N4P573_BCL2A1-      ca------------------------------------------------
A0A7N4P7T7_BCL2L10      cg-------------------gggcgatgct-------------------
A0A7N4PRP1_MCL1-01      cagagagggtggggacacatcgagcaatgcccgcggctcactgccctcaa
A0A7N4PRP1_MCL1-02      cagagagggtggggacacatcgagcaatgcccgcggctcactgccctcaa
A0A7N4PRP1_MCL1-03      cagagagggtggggacacatcgagcaatgcccgcggctcactgccctcaa
A0A7N4PQN7_BCL2-01      cg---------------------aagatatcgaag---------------
A0A7N4P3X2_BCL2L1-      ct---------------------ccggtaccggcg---------------
A0A7N4P3X2_BCL2L1-      ct---------------------ccggtaccggcg---------------
                        *                                                 

A0A7N4P573_BCL2A1-      --------------------------------------------cagtaa
A0A7N4P573_BCL2A1-      --------------------------------------------ctttgg
A0A7N4P573_BCL2A1-      --------------------------------------------ctttgg
A0A7N4P573_BCL2A1-      --------------------------------------------ctttgg
A0A7N4P7T7_BCL2L10      -------------------ggagatggaggagcaggagaagcagcagcga
A0A7N4PRP1_MCL1-01      cgccgcccccggccgaggaggacgaggacgaggaggaggatgagttgtac
A0A7N4PRP1_MCL1-02      cgccgcccccggccgaggaggacgaggacgaggaggaggatgagttgtac
A0A7N4PRP1_MCL1-03      cgccgcccccggccgaggaggacgaggacgaggaggaggatgagttgtac
A0A7N4PQN7_BCL2-01      -------------------agatttcgatgaaatgtcaggtcagctgcac
A0A7N4P3X2_BCL2L1-      -------------------ggcattcagtgatctgacatcccagctccac
A0A7N4P3X2_BCL2L1-      -------------------ggcattcagtgatctgacatcccagctccac
                                                                          

A0A7N4P573_BCL2A1-      atatca-------aga----------------gtctcag-ag--------
A0A7N4P573_BCL2A1-      acattacttctgtaga--------------ttgtgccagaag--------
A0A7N4P573_BCL2A1-      acattacttctgtaga--------------ttgtgccagaag--------
A0A7N4P573_BCL2A1-      acattacttctgtaga--------------ttgtgccagaag--------
A0A7N4P7T7_BCL2L10      gggcggctccggagcgagatgagccggcgcctggccgaggag--------
A0A7N4PRP1_MCL1-01      gggcagtccttggagttgataacccgatacctccgcgagcaggcggtcgg
A0A7N4PRP1_MCL1-02      gggcagtccttggagttgataacccgatacctccgcgagcaggcggtcgg
A0A7N4PRP1_MCL1-03      gggcagtccttggagttgataacccgatacctccgcgagcaggcggtcgg
A0A7N4PQN7_BCL2-01      --ctgacccctgttactgctaggggacgctttgccacagtag--------
A0A7N4P3X2_BCL2L1-      --atcactccagggacggcttatcagagttttgagcaggtag--------
A0A7N4P3X2_BCL2L1-      --atcactccagggacggcttatcagagttttgagcaggtag--------
                                                              * **        

A0A7N4P573_BCL2A1-      ----------aattt----caatctt------------t-----------
A0A7N4P573_BCL2A1-      ----------aattttcaacagtgttatggaaaaggaat-----------
A0A7N4P573_BCL2A1-      ----------aattttcaacagtgttatggaaaaggaat-----------
A0A7N4P573_BCL2A1-      ----------aattttcaacagtgttatggaaaaggaat-----------
A0A7N4P7T7_BCL2L10      -----------ctctgccactatctggtggagaagaa------------g
A0A7N4PRP1_MCL1-01      caccaaggacaccaagcccctacgcagtgggaaggcactggagaccctgc
A0A7N4PRP1_MCL1-02      caccaaggacaccaagcccctacgcagtgggaaggcactggagaccctgc
A0A7N4PRP1_MCL1-03      caccaaggacaccaagcccctacgcagtgggaaggcactggagaccctgc
A0A7N4PQN7_BCL2-01      ---------------------------tggaagagctgt-----------
A0A7N4P3X2_BCL2L1-      ---------------------------tgaatgaactct-----------
A0A7N4P3X2_BCL2L1-      ---------------------------tgaatgaactct-----------
                                                                          

A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P7T7_BCL2L10      ggcgcgtgg-------------------ctgcggg---------------
A0A7N4PRP1_MCL1-01      ggcgcgtgggagacggtgtccagaggaaccacgagacggctttccaaggt
A0A7N4PRP1_MCL1-02      ggcgcgtgggagacggtgtccagaggaaccacgagacggctttccaaggt
A0A7N4PRP1_MCL1-03      ggcgcgtgggagacggtgtccagaggaaccacgagacggctttccaaggt
A0A7N4PQN7_BCL2-01      --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
                                                                          

A0A7N4P573_BCL2A1-      -------------------ctaagcat-gca-------------------
A0A7N4P573_BCL2A1-      -------------------ttgaggatggca-------------------
A0A7N4P573_BCL2A1-      -------------------ttgaggatggca-------------------
A0A7N4P573_BCL2A1-      -------------------ttgaggatggca-------------------
A0A7N4P7T7_BCL2L10      ----------------------agaacggag-------------------
A0A7N4PRP1_MCL1-01      atgcttcgcaaactggatatcaagaacgaagaggacattaaggccgtgtc
A0A7N4PRP1_MCL1-02      atgcttcgcaaactggatatcaagaacgaagaggacattaaggccgtgtc
A0A7N4PRP1_MCL1-03      atgcttcgcaaactggatatcaagaacgaagaggacattaaggccgtgtc
A0A7N4PQN7_BCL2-01      -------------------tcagggatgggg-------------------
A0A7N4P3X2_BCL2L1-      -------------------tccgggatgggg-------------------
A0A7N4P3X2_BCL2L1-      -------------------tccgggatgggg-------------------
                                               * *                        

A0A7N4P573_BCL2A1-      --------------------------------ggatgaaattgagacaga
A0A7N4P573_BCL2A1-      --------------------------------tcatcaactggggacgga
A0A7N4P573_BCL2A1-      --------------------------------tcatcaactggggacgga
A0A7N4P573_BCL2A1-      --------------------------------tcatcaactggggacgga
A0A7N4P7T7_BCL2L10      ---------------------------------gctggactgg-------
A0A7N4PRP1_MCL1-01      tcgcgtggtaactcatgtgttcagtgacggggtgacgaattggggcagaa
A0A7N4PRP1_MCL1-02      tcgcgtggtaactcatgtgttcagtgacggggtgacgaattggggcagaa
A0A7N4PRP1_MCL1-03      tcgcgtggtaactcatgtgttcagtgacggggtgacgaattggggcagaa
A0A7N4PQN7_BCL2-01      -----------------------------------tgaactgggggcgga
A0A7N4P3X2_BCL2L1-      -----------------------------------tgaactggggccgaa
A0A7N4P3X2_BCL2L1-      -----------------------------------tgaactggggccgaa
                                                              * * *       

A0A7N4P573_BCL2A1-      ----------------------agaaattatca--aggatatt--tttaa
A0A7N4P573_BCL2A1-      ttgtcaccatatttgcttttgggggaattctcattaagaaact--tctga
A0A7N4P573_BCL2A1-      ttgtcaccatatttgcttttgggggaattctcattaagaaact--tctga
A0A7N4P573_BCL2A1-      ttgtcaccatatttgcttttgggggaattctcattaagaaact--tctga
A0A7N4P7T7_BCL2L10      ctttcaccaccacttcacccagaagcagcctcccccacaaagtgatccaa
A0A7N4PRP1_MCL1-01      ttgtgactctcatttctttcgg----ggcctttgtggcaaagc-acttga
A0A7N4PRP1_MCL1-02      ttgtgactctcatttctttcgg----ggcctttgtggcaaagc-acttga
A0A7N4PRP1_MCL1-03      ttgtgactctcatttctttcgg----ggcctttgtggcaaagc-acttga
A0A7N4PQN7_BCL2-01      ttgtggccttctttgaatttggtggtgttatgtgtg-----------tgg
A0A7N4P3X2_BCL2L1-      ttgtggcattcttctccttcggaggggcattgtgtg-----------tgg
A0A7N4P3X2_BCL2L1-      ttgtggcattcttctccttcggaggggcattgtgtg-----------tgg
                                                      *                   

A0A7N4P573_BCL2A1-      ---acaaggc--------------------------aaaac---at----
A0A7N4P573_BCL2A1-      gacacagagctccactgact---atggacactcatgaagaa---atttct
A0A7N4P573_BCL2A1-      gacacagagctccactgact---atggacactcatgaagaa---atttct
A0A7N4P573_BCL2A1-      gacacagagctccactgact---atggacactcatgaagaa---atttct
A0A7N4P7T7_BCL2L10      agagt----------------------accc-------------------
A0A7N4PRP1_MCL1-01      agagcataaaccaggaaagttgcatagacccgctagcagaaagcataac-
A0A7N4PRP1_MCL1-02      agagcataaaccaggaaagttgcatagacccgctagcagaaagcataac-
A0A7N4PRP1_MCL1-03      agagcataaaccaggaaagttgcatagacccgctagcagaaagcataac-
A0A7N4PQN7_BCL2-01      agagcgtcaaccgggag------atgtcgcctctggtggacagcatagcc
A0A7N4P3X2_BCL2L1-      aaagcgtggataaagag------atggaagtcttggtagcacgcatcacc
A0A7N4P3X2_BCL2L1-      aaagcgtggataaagag------atggaagtcttggtagcacgcatcacc
                                                                          

A0A7N4P573_BCL2A1-      -gttttatc-cctcgatacaaattcaata--gtaactacatggatatggt
A0A7N4P573_BCL2A1-      cattttatt-gctgagttcataatgaacaacatagcagaatggataagac
A0A7N4P573_BCL2A1-      cattttatt-gctgagttcataatgaacaacatagcagaatggataagac
A0A7N4P573_BCL2A1-      cattttatt-gctgagttcataatgaacaacatagcagaatggataagac
A0A7N4P7T7_BCL2L10      -------tgtgctgtatag-------------tggcc-----gccgcagg
A0A7N4PRP1_MCL1-01      ----agatgtcctggttaaatcgaaaagggactggct-----gatgaagc
A0A7N4PRP1_MCL1-02      ----agatgtcctggttaaatcgaaaagggactggct-----gatgaagc
A0A7N4PRP1_MCL1-03      ----agatgtcctggttaaatcgaaaagggactggct-----gatgaagc
A0A7N4PQN7_BCL2-01      ctgtggatg-actgagtacctgaaccggcacctgcacaactggatccagg
A0A7N4P3X2_BCL2L1-      tcctggatg-gccacttacttggatgagcacctagacccatggatccaag
A0A7N4P3X2_BCL2L1-      tcctggatg-gccacttacttggatgagcacctagacccatggatccaag
                               *   *    *               *         *       

A0A7N4P573_BCL2A1-      caggt---------------------------------------------
A0A7N4P573_BCL2A1-      aaaatggaggat--------------------------------------
A0A7N4P573_BCL2A1-      aaaatggaggatgggtgattgctcacagtaaatatcaagagtctcagaga
A0A7N4P573_BCL2A1-      aaaatggaggatg-------------------------------------
A0A7N4P7T7_BCL2L10      atttggactggt--------------------------------------
A0A7N4PRP1_MCL1-01      agaagggctggg--------------------------------------
A0A7N4PRP1_MCL1-02      agaagggctggg--------------------------------------
A0A7N4PRP1_MCL1-03      agaagggctggg--------------------------------------
A0A7N4PQN7_BCL2-01      ataacggaggat--------------------------------------
A0A7N4P3X2_BCL2L1-      aaaatggcggtt--------------------------------------
A0A7N4P3X2_BCL2L1-      aaaatggcggtt--------------------------------------
                                                                          

A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      atttcaatctttctaagcatgcaggatgaaattgagacagaagaaattat
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P7T7_BCL2L10      --------------------------------------------------
A0A7N4PRP1_MCL1-01      --------------------------------------------------
A0A7N4PRP1_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-03      --------------------------------------------------
A0A7N4PQN7_BCL2-01      --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
                                                                          

A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      caaggatatttttaaacaaggcaaaacatgttttatccctcgatacaaat
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P7T7_BCL2L10      --------------------------------------------------
A0A7N4PRP1_MCL1-01      --------------------------------------------------
A0A7N4PRP1_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-03      --------------------------------------------------
A0A7N4PQN7_BCL2-01      --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
                                                                          

A0A7N4P573_BCL2A1-      ------------------------------tattttcagctgaagaaatt
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      tcaatagtaactacatggatatggtcaggttattttcagctgaagaaatt
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P7T7_BCL2L10      --------------------------------------------------
A0A7N4PRP1_MCL1-01      --------------------------------------------------
A0A7N4PRP1_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-03      --------------------------------------------------
A0A7N4PQN7_BCL2-01      --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
                                                                          

A0A7N4P573_BCL2A1-      ttttcacttcccaaaacatcctggaacattcatcagcctggtgatgatga
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      ttttcacttcccaaaacatcctggaacattcatcagcctggtgatgatga
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P7T7_BCL2L10      --------------------------------------------------
A0A7N4PRP1_MCL1-01      --------------------------------------------------
A0A7N4PRP1_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-03      --------------------------------------------------
A0A7N4PQN7_BCL2-01      --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
                                                                          

A0A7N4P573_BCL2A1-      agtacgggaggaggctttgtctaccggg--------ggtctggatctcat
A0A7N4P573_BCL2A1-      -------------------------ggg--------aaaatgg-------
A0A7N4P573_BCL2A1-      agtacgggaggaggctttgtctaccggg--------ggtctggatctcat
A0A7N4P573_BCL2A1-      -------------------------ggg--------ggtctggatctcat
A0A7N4P7T7_BCL2L10      -------------------------ggg----------------------
A0A7N4PRP1_MCL1-01      -------------------------agatgcccctgtgtgacctcagatg
A0A7N4PRP1_MCL1-02      -------------------------agg---------------------g
A0A7N4PRP1_MCL1-03      -------------------------agg---------------------g
A0A7N4PQN7_BCL2-01      -------------------------ggg------------------atgc
A0A7N4P3X2_BCL2L1-      -------------------------ggg------------------acac
A0A7N4P3X2_BCL2L1-      -------------------------ggg------------------acac
                                                  *                       

A0A7N4P573_BCL2A1-      cttcatgccaggtcttggatttgac----caacagggaaaccgcctggga
A0A7N4P573_BCL2A1-      cttcataaagaactttgaac----c----caatatggta------tggcc
A0A7N4P573_BCL2A1-      cttcatgccaggtcttggatttgac----caacagggaaaccgcctggga
A0A7N4P573_BCL2A1-      cttcatgccaggtcttggatttgac----caacagggaaaccgcctggga
A0A7N4P7T7_BCL2L10      --------------------------------------------------
A0A7N4PRP1_MCL1-01      gtccctgcaacccagcccttctccagtaa-------tgaaccttcttgtc
A0A7N4PRP1_MCL1-02      gtttgtggaattc------tttcatgtag-------aggacct-------
A0A7N4PRP1_MCL1-03      gtttgtggaattc------tttcatgtag-------aggacct-------
A0A7N4PQN7_BCL2-01      ctttgtggaattatatg--------gcaacagcatgagac----------
A0A7N4P3X2_BCL2L1-      cttcgtggagctttatgggaatgatgcagcagcagagagccggaagggcc
A0A7N4P3X2_BCL2L1-      cttcgtggagctttatgggaatgatgcagcagcagagagccggaagggcc
                                                                          

A0A7N4P573_BCL2A1-      agggggaagggatactatgacacttacctgaagagatgcttccaacacca
A0A7N4P573_BCL2A1-      aaacttcacagatatttcaacaaagatctgg-------------------
A0A7N4P573_BCL2A1-      agggggaagggatactatgacacttacctgaagagatgcttccaacacca
A0A7N4P573_BCL2A1-      agggggaagggatactatgacacttacctga-------------------
A0A7N4P7T7_BCL2L10      --------------------------------------------------
A0A7N4PRP1_MCL1-01      tccgagtattcaaaaggtagt----ggactg-------------------
A0A7N4PRP1_MCL1-02      -----------agaaggtggcatcagaaatg-------------------
A0A7N4PRP1_MCL1-03      -----------agaaggtggcatcagaaatg-------------------
A0A7N4PQN7_BCL2-01      -------ctttgttcgatttctcctggctgt-------------------
A0A7N4P3X2_BCL2L1-      aggaacgcttcaacagatggctgctgactgg-------------------
A0A7N4P3X2_BCL2L1-      aggaacgcttcaacagatggctgctgactgg-------------------
                                                                          

A0A7N4P573_BCL2A1-      aaaaagaagaccttacacaattgctttggctttcaaagagcagatctgtg
A0A7N4P573_BCL2A1-      ------------------aatgtattttcctttctg--------------
A0A7N4P573_BCL2A1-      aaaaagaagaccttacacaattgctttggctttcaaagagcagatctgtg
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P7T7_BCL2L10      --------------------------------------------------
A0A7N4PRP1_MCL1-01      -----------------------------------ggtgtcttatgtgag
A0A7N4PRP1_MCL1-02      -----------------------------------tgctgctcgcctttg
A0A7N4PRP1_MCL1-03      -----------------------------------tgctgctcgcctttg
A0A7N4PQN7_BCL2-01      -----------------------------------ctctgaagactctcc
A0A7N4P3X2_BCL2L1-      -----------------------------------c----atgacagtgg
A0A7N4P3X2_BCL2L1-      -----------------------------------c----atgacagtgg
                                                                          

A0A7N4P573_BCL2A1-      atgcagtgccagtgggagaagatgatatgagaatagatgaagtgctctat
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P573_BCL2A1-      atgcagtgccagtgggagaagatgatatgagaatagatgaagtgctctat
A0A7N4P573_BCL2A1-      --------------------------------------------------
A0A7N4P7T7_BCL2L10      -----------------------------------attagctcttctatt
A0A7N4PRP1_MCL1-01      caaggttggcaatatctggtgctggtgcccttttggttagctttgcta--
A0A7N4PRP1_MCL1-02      ccggtgttgctggagtaggagctggt----------ttggcatatctaat
A0A7N4PRP1_MCL1-03      ccggtgttgctggagtaggagctggt----------ttggcatatctaat
A0A7N4PQN7_BCL2-01      tcagcctggctctggtgggagcttgcatcactc---ttggtgcctaccta
A0A7N4P3X2_BCL2L1-      ctggtgtagtcctgctgg--------------------ggtccctgttca
A0A7N4P3X2_BCL2L1-      ctggtgtagtcctgctgg--------------------ggtccctgttca
                                                                          

A0A7N4P573_BCL2A1-      gaagaca-aataa-----
A0A7N4P573_BCL2A1-      ------a-agtaa-----
A0A7N4P573_BCL2A1-      gaagaca-aataa-----
A0A7N4P573_BCL2A1-      ------------------
A0A7N4P7T7_BCL2L10      agccgtacgataa-----
A0A7N4PRP1_MCL1-01      aa------ggtgttttga
A0A7N4PRP1_MCL1-02      aa------gatag-----
A0A7N4PRP1_MCL1-03      aa------gatag-----
A0A7N4PQN7_BCL2-01      ggacaca-agtga-----
A0A7N4P3X2_BCL2L1-      -gccgga-agtga-----
A0A7N4P3X2_BCL2L1-      -gccgga-agtga-----
                                          

© 1998-2022Legal notice