Dataset for CDS BCL-2-like of organism Labrus bergylta

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q3G1D7_BCL2-01      atggc-------------gaacgagtg-----------------------
A0A3Q3EZT5_BCL2L10      atgt---------gcagagcgcagtctgatatc-----------------
A0A3Q3EZT5_BCL2L10      atgt---------gcagagcgcagtctgatatc-----------------
A0A3Q3GP42_MCL1-01      atggatatcattaatatgaagcgggcggcggtcagcgtatctgccggagt
A0A3Q3FUB6_BCL2L1-      atgtcatacagtaacagagagctggtggagttc---------------tt
A0A3Q3G2E1_BCL2L1-      atgtctcaa---aacagagaactagtggttttc---------------ta
A0A3Q3G2E1_BCL2L1-      atgtctcaa---aacagagaactagtggttttc---------------ta
A0A3Q3G2E1_BCL2L1-      atgtctcaa---aacagagaactagtggttttc---------------ta
                        ***                  *                            

A0A3Q3G1D7_BCL2-01      --taatcgcaacattgt---------------------------------
A0A3Q3EZT5_BCL2L10      -----gctgggag-------------------------------------
A0A3Q3EZT5_BCL2L10      -----gctgggag-------------------------------------
A0A3Q3GP42_MCL1-01      catgagctttatgatgccacaaaatggagtcgggaagggacagatgcact
A0A3Q3FUB6_BCL2L1-      cataagctacaaactgtctcaga---------------------------
A0A3Q3G2E1_BCL2L1-      cataacctataaattctctcaga---------------------------
A0A3Q3G2E1_BCL2L1-      cataacctataaattctctcaga---------------------------
A0A3Q3G2E1_BCL2L1-      cataacctataaattctctcaga---------------------------

A0A3Q3G1D7_BCL2-01      -------ggaaaagtat--------------------atctgtcataaac
A0A3Q3EZT5_BCL2L10      -------gaaaatgtc----------------------------------
A0A3Q3EZT5_BCL2L10      -------gaaaatgtc----------------------------------
A0A3Q3GP42_MCL1-01      acggcccggaagcgtcctctccacaaatagcgatgggatcctctttagcc
A0A3Q3FUB6_BCL2L1-      -------ggaactatcc-----------------------------aacc
A0A3Q3G2E1_BCL2L1-      -------gaaattatcctcttaat------cacatggaactcttagagcc
A0A3Q3G2E1_BCL2L1-      -------gaaattatcctcttaat------cacatggaactcttagagcc
A0A3Q3G2E1_BCL2L1-      -------gaaattatcctcttaat------cacatggaactcttagagcc
                               * **   *                                   

A0A3Q3G1D7_BCL2-01      tctccaaacggggctacgagtggggattcgaggatgagcaggatga----
A0A3Q3EZT5_BCL2L10      -------------------gtgcgggctgtggaaag--------------
A0A3Q3EZT5_BCL2L10      -------------------gtgcgggctgtggaaag--------------
A0A3Q3GP42_MCL1-01      tcacaaaatgggaat----gtcgggtcgaatgaaaccaccaagcggccca
A0A3Q3FUB6_BCL2L1-      tatgtgctgaggtca----gaggatgctggtgaaaggactgaggga----
A0A3Q3G2E1_BCL2L1-      tccaaac--aggact----gatggggc-gggggcagggtcgggtga----
A0A3Q3G2E1_BCL2L1-      tccaaac--aggact----gatggggc-gggggcagggtcgggtga----
A0A3Q3G2E1_BCL2L1-      tccaaac--aggact----gatggggc-gggggcagggtcgggtga----
                                           *           *                  

A0A3Q3G1D7_BCL2-01      ----------------------agatgctgctaataacgggtcattagtt
A0A3Q3EZT5_BCL2L10      ----------------------agaccctggctctggcagaggactacct
A0A3Q3EZT5_BCL2L10      ----------------------agaccctggctctggcagaggactacct
A0A3Q3GP42_MCL1-01      aggctctggttgttaactcgggaaacgacgatat-cgaagacggctcgct
A0A3Q3FUB6_BCL2L1-      --------------gacatggaaaactctgctgc-cagtaatggcttttt
A0A3Q3G2E1_BCL2L1-      --------------ggaacagcaggtagcgacgcacgccaacgggactt-
A0A3Q3G2E1_BCL2L1-      --------------ggaacagcaggtagcgacgcacgccaacgggactt-
A0A3Q3G2E1_BCL2L1-      --------------ggaacagcaggtagcgacgcacgccaacgggactt-
                                              *      *                    

A0A3Q3G1D7_BCL2-01      gcccctccgccgactttggttcgccggtgccgtgaagcgagctccgggcc
A0A3Q3EZT5_BCL2L10      gtccctgtgc-----------------------------tgcacaagccc
A0A3Q3EZT5_BCL2L10      gtccctgtgc-----------------------------tgcacaagccc
A0A3Q3GP42_MCL1-01      g---ccgtgc-----------------------------accccggagcc
A0A3Q3FUB6_BCL2L1-      g---gtcaac-----------------------------agca-------
A0A3Q3G2E1_BCL2L1-      -----ttaac-----------------------------ggcacgagtcc
A0A3Q3G2E1_BCL2L1-      -----ttaac-----------------------------ggcacgagtcc
A0A3Q3G2E1_BCL2L1-      -----ttaac-----------------------------ggcacgagtcc
                                 *                               *        

A0A3Q3G1D7_BCL2-01      tgaccgtgagagca---tcccccacctctgcaaacggcccccccagtc--
A0A3Q3EZT5_BCL2L10      ac----------------ggccagcccctccac-ctcccagc-atgtc--
A0A3Q3EZT5_BCL2L10      ac----------------ggccagcccctccac-ctcccagc-atgtc--
A0A3Q3GP42_MCL1-01      ggacagtgaaaccgaagtctccagctgtccca--ctgggggcgaagtcct
A0A3Q3FUB6_BCL2L1-      -------ggaaccg----ggccggc---------cagtcagtgatgtc--
A0A3Q3G2E1_BCL2L1-      ------tggaaccc----ccccagcgtccccacaccggcagcagcaac--
A0A3Q3G2E1_BCL2L1-      ------tggaaccc----ccccagcgtccccacaccggcagcagcaac--
A0A3Q3G2E1_BCL2L1-      ------tggaaccc----ccccagcgtccccacaccggcagcagcaac--
                                            **  *         *            *  

A0A3Q3G1D7_BCL2-01      --cgacccagcctacgcg--------------------------------
A0A3Q3EZT5_BCL2L10      ----agccgct---------------------------------------
A0A3Q3EZT5_BCL2L10      ----agccgct---------------------------------------
A0A3Q3GP42_MCL1-01      ggagagcgacaccaggcaactcatcagcgccttcctcagagagcatactg
A0A3Q3FUB6_BCL2L1-      ----atcatccccacacacc--------------------gaca----ta
A0A3Q3G2E1_BCL2L1-      ----aacggttaccagcaac--------------------gacgaatctg
A0A3Q3G2E1_BCL2L1-      ----aacggttaccagcaac--------------------gacgaatctg
A0A3Q3G2E1_BCL2L1-      ----aacggttaccagcaac--------------------gacgaatctg
                            * *                                           

A0A3Q3G1D7_BCL2-01      -----------------------------------------gatatccac
A0A3Q3EZT5_BCL2L10      -----------------------------------------gctataagg
A0A3Q3EZT5_BCL2L10      -----------------------------------------gctataagg
A0A3Q3GP42_MCL1-01      ggctttcaaagcctggttggaatgagagtagtgcactatcgacgatgaaa
A0A3Q3FUB6_BCL2L1-      gag--------------------------------------gctgtaaag
A0A3Q3G2E1_BCL2L1-      gac--------------------------------------gcggtgaag
A0A3Q3G2E1_BCL2L1-      gac--------------------------------------gcggtgaag
A0A3Q3G2E1_BCL2L1-      gac--------------------------------------gcggtgaag

A0A3Q3G1D7_BCL2-01      agagtcctgcgcgaggctggagatgaacttgaaagactttaccagccgga
A0A3Q3EZT5_BCL2L10      cgcctggcccaggacatggagaagcagcaccaggccc-----------gc
A0A3Q3EZT5_BCL2L10      cgcctggcccaggacatggagaagcagcaccaggccc-----------gc
A0A3Q3GP42_MCL1-01      agagtcgtggaggacg-tgctggcgaaacacagatac-----------gc
A0A3Q3FUB6_BCL2L1-      gcagctcttctggactctgcagatgagtttgagcttctctttacgcaggc
A0A3Q3G2E1_BCL2L1-      gaggccctccgggactcggccaacgagtttgagctgcgatatgccagcgc
A0A3Q3G2E1_BCL2L1-      gaggccctccgggactcggccaacgagtttgagctgcgatatgccagcgc
A0A3Q3G2E1_BCL2L1-      gaggccctccgggactcggccaacgagtttgagctgcgatatgccagcgc
                                    **    *      *     *    *           * 

A0A3Q3G1D7_BCL2-01      cttcacg-----gagatgtcgcggcagctgtatctcacctccaccacg--
A0A3Q3EZT5_BCL2L10      ttccaatccctggctcagaccttcctgaggcagtgcgggccggac-----
A0A3Q3EZT5_BCL2L10      ttccaatccctggctcagaccttcctgaggcagtgcgggccggac-----
A0A3Q3GP42_MCL1-01      gtataat-----ggtatgatcaacaaactg----tcact-ggaagacaga
A0A3Q3FUB6_BCL2L1-      ctttagt-----gacctttcctcgcagcttgacattactcccaacaca--
A0A3Q3G2E1_BCL2L1-      cttcagc-----gatctgcacaaccagctgcacatcacgccggccaca--
A0A3Q3G2E1_BCL2L1-      cttcagc-----gatctgcacaaccagctgcacatcacgccggccaca--
A0A3Q3G2E1_BCL2L1-      cttcagc-----gatctgcacaaccagctgcacatcacgccggccaca--
                         *  *       *                                     

A0A3Q3G1D7_BCL2-01      ---gcgcagaggaggttcgccgaggtgatagacgaac---tgtttcggga
A0A3Q3EZT5_BCL2L10      ---ccctgctccggtcttaggaaggtgatggaggaac---tggtgggaga
A0A3Q3EZT5_BCL2L10      ---ccctgctccggtcttaggaaggtgatggaggaac---tggtgggaga
A0A3Q3GP42_MCL1-01      ggggacgatgcaagttttgtcagcgctgtggcaaagagcctttttgcgga
A0A3Q3FUB6_BCL2L1-      ---gcctatcacagctttaagagtgtgatggacgagg---ttttcaagga
A0A3Q3G2E1_BCL2L1-      ---acccaccagagctttgagaacgtgatggacgagg---tgttccggga
A0A3Q3G2E1_BCL2L1-      ---acccaccagagctttgagaacgtgatggacgagg---tgttccggga
A0A3Q3G2E1_BCL2L1-      ---acccaccagagctttgagaacgtgatggacgagg---tgttccggga
                                     *  *       *   * *   *     *  *    **

A0A3Q3G1D7_BCL2-01      cgg---ggtgaactggggccggattatcgcctttttcgagttcgggggca
A0A3Q3EZT5_BCL2L10      tggacacttgaactggggaagggttgtatcccttttcacctttactgggg
A0A3Q3EZT5_BCL2L10      tggacacttgaactggggaagggttgtatcccttttcacctttactgggg
A0A3Q3GP42_MCL1-01      tggaacaacaaactggggcaggatcgccagcctggtcgcttttggagcgg
A0A3Q3FUB6_BCL2L1-      tgg---agtcaactgggggcgtatagtaggcctgtttgcctttggcggtg
A0A3Q3G2E1_BCL2L1-      cgg---agtcaactggggccgcatcgtggggctctttgctttcggcgggg
A0A3Q3G2E1_BCL2L1-      cgg---agtcaactggggccgcatcgtggggctctttgctttcggcgggg
A0A3Q3G2E1_BCL2L1-      cgg---agtcaactggggccgcatcgtggggctctttgctttcggcgggg
                         **       ********  *  *        *  *    **    *   

A0A3Q3G1D7_BCL2-01      cggtg--------------tgcgtgg-agtgcatgtcc------------
A0A3Q3EZT5_BCL2L10      tgctggccagacaactgcaggagcaggaggatgtgaagctggggctggac
A0A3Q3EZT5_BCL2L10      tgctggccagacaactgcaggagcaggaggatgtgaagctggggctggac
A0A3Q3GP42_MCL1-01      c------------------tgtgtcacaatacctgaag------------
A0A3Q3FUB6_BCL2L1-      tactg--------------tgtgtgg-aatgcgtccag------------
A0A3Q3G2E1_BCL2L1-      cgctg--------------tgtgtcg-agtgcgtggag------------
A0A3Q3G2E1_BCL2L1-      cgctg--------------tgtgtcg-agtgcgtggag------------
A0A3Q3G2E1_BCL2L1-      cgctg--------------tgtgtcg-agtgcgtggag------------
                                            * *    *     *                

A0A3Q3G1D7_BCL2-01      --------------aaacaggagatgacatcgcaggtggacaaca----t
A0A3Q3EZT5_BCL2L10      cctgtgcaggggcagaaactgggacagggacccgggcactgcaggggact
A0A3Q3EZT5_BCL2L10      cctgtgcaggggcagaaactgggacagggacccgggcactgcaggggact
A0A3Q3GP42_MCL1-01      --------------gagaatggcagggggcactgtgtggagctgg----t
A0A3Q3FUB6_BCL2L1-      --------------aaggat---atgggtgaactggtttcccgca----t
A0A3Q3G2E1_BCL2L1-      --------------aaggag---atgagtcccctcgttggcagga----t
A0A3Q3G2E1_BCL2L1-      --------------aaggag---atgagtcccctcgttggcagga----t
A0A3Q3G2E1_BCL2L1-      --------------aaggag---atgagtcccctcgttggcagga----t
                                       *       *           *             *

A0A3Q3G1D7_BCL2-01      cgcagagtggatgacggagtatttg------aatggacctctgaacagct
A0A3Q3EZT5_BCL2L10      ggcagagaccatagctgactacctg------ggagaggagaaaaaagagt
A0A3Q3EZT5_BCL2L10      ggcagagaccatagctgactacctg------ggagaggagaaaaaagagt
A0A3Q3GP42_MCL1-01      ggggcaggagatctccacgtacctgctgtctgaccaccgggactggct--
A0A3Q3FUB6_BCL2L1-      cgcaggctggatgactacgtacctg------gatgagcacattagtgcat
A0A3Q3G2E1_BCL2L1-      catagagtggatgactgtctacctg------gacaaccgaattcaacctt
A0A3Q3G2E1_BCL2L1-      catagagtggatgactgtctacctg------gacaaccgaattcaacctt
A0A3Q3G2E1_BCL2L1-      catagagtggatgactgtctacctg------gacaaccgaattcaacctt
                                  **  *    **  **                         

A0A3Q3G1D7_BCL2-01      ggatacaagataacggtggatgggatgcctttgtggagctgtac------
A0A3Q3EZT5_BCL2L10      ggcttctggagaatgacggatgggagggattctgtgagttctcc---cgc
A0A3Q3EZT5_BCL2L10      ggcttctggagaatgacggatgggagggattctgtgagttctcc---cgc
A0A3Q3GP42_MCL1-01      -ggtcaaaaacaa---cgcctgggacggctttgtcgagttcttt---cga
A0A3Q3FUB6_BCL2L1-      ggatcgagagccagggaggatgggactgctttgttgaaattttcggacgg
A0A3Q3G2E1_BCL2L1-      ggatcgagagccaaggaggatgggagcgcttctctgaaatctttgggcag
A0A3Q3G2E1_BCL2L1-      ggatcgagagccaaggaggatgggagcgcttctctgaaatctttgggcag
A0A3Q3G2E1_BCL2L1-      ggatcgagagccaaggaggatgggagcgcttctctgaaatctttgggcag
                         * *        *    *  *****    **    **  * *        

A0A3Q3G1D7_BCL2-01      ---gacagacagagagactcggccttctgctcctcctggccctccattaa
A0A3Q3EZT5_BCL2L10      agcgctagagagacgagccagg---------------actcgtccatgaa
A0A3Q3EZT5_BCL2L10      agcgctagagagacgagccagg---------------actcgtccatgaa
A0A3Q3GP42_MCL1-01      gtagc---------agacccag---------------agtccacagtgag
A0A3Q3FUB6_BCL2L1-      ggcgct-gttggagaagtgagg---------------agatctcgggaaa
A0A3Q3G2E1_BCL2L1-      gatgcg-gcgggagagatcagg---------------aggtctcaggaga
A0A3Q3G2E1_BCL2L1-      gatgcg-gcgggagagatcagg---------------aggtctcaggaga
A0A3Q3G2E1_BCL2L1-      gatgcg-gcgggagagatcagg---------------aggtctcaggaga
                           *                 *                     *      

A0A3Q3G1D7_BCL2-01      gaca--------gtcttcggtctggcagcactcggggcggctagcctcac
A0A3Q3EZT5_BCL2L10      gacggcactgtttgct---------------gc-ggctggtgtgggcctt
A0A3Q3EZT5_BCL2L10      gacggcactgtttgct---------------gc-ggctggtgtgggcctt
A0A3Q3GP42_MCL1-01      gacaacactcatggctttt-gctgggtt--cgc-agg-aattggggccac
A0A3Q3FUB6_BCL2L1-      ctctcaccagatggctgctagttggaatggcgc-tgctaatgggagtcgt
A0A3Q3G2E1_BCL2L1-      gtttcaaaaagtggctgctggcggggatgacgc-tggtgaccggggtcgt
A0A3Q3G2E1_BCL2L1-      gtttcaaaaagtggctgctggcggggatgacgc-tggtgaccggggtcgt
A0A3Q3G2E1_BCL2L1-      gtttcaaaaagtggctgctggcggggatgacgc-tggtgaccggggtcgt
                                      **                *  *       *   *  

A0A3Q3G1D7_BCL2-01      cattggagcatacctt-----acacagaaa------tga
A0A3Q3EZT5_BCL2L10      gctggactcactttcctcctgatccgagtgcaggcctga
A0A3Q3EZT5_BCL2L10      gctggactcactttcctcctggtgcg---------ctag
A0A3Q3GP42_MCL1-01      gttggccctgttgatc-----a------------ggtga
A0A3Q3FUB6_BCL2L1-      ggttggtgtttacatc-----gctaagaaacat---taa
A0A3Q3G2E1_BCL2L1-      ggtgggctcactcatc-----gcccagaaacgcctgtag
A0A3Q3G2E1_BCL2L1-      ggtgggctcactcatc-----gcccagaaacgcctgtag
A0A3Q3G2E1_BCL2L1-      ggtgggctcactcatc-----gcccagaaacgcctgtag
                          * *                               *  

© 1998-2020Legal notice