Dataset for CDS BCL2L2 of organism Microcebus murinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B7FJ73_BCL2L2-      atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtc-
A0A8B7FJ73_BCL2L2-      atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtc-
A0A8B7FJ73_BCL2L2-      atggcgaccccagcctcagccccagacaca-cgggctctggtggcagact
A0A8B7FJ73_BCL2L2-      atggcgaccccagcctcagccccagacaca-cgggctctggtggcagact
                        ****** *  * **  * **  ***   ** ****  ***  *** * * 

A0A8B7FJ73_BCL2L2-      ---ggggctccgggccggggcggcggcgccatct-tgtgcccggggccgg
A0A8B7FJ73_BCL2L2-      ---ggggctccgggccggggcggcggcgccatct-tgtgcccggggccgg
A0A8B7FJ73_BCL2L2-      ttgtaggctataagctgaggcagaaaggttatgtctgtggagctggccca
A0A8B7FJ73_BCL2L2-      ttgtaggctataagctgaggcagaaaggttatgtctgtggagctggccca
                             ****    ** * *** *    *  ** * ****     ****  

A0A8B7FJ73_BCL2L2-      tggggaggccggggagggggccc----------------cggggggc-gc
A0A8B7FJ73_BCL2L2-      tggggaggccggggagggggccc----------------cggggggc-gc
A0A8B7FJ73_BCL2L2-      ggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgg
A0A8B7FJ73_BCL2L2-      ggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgg
                         ***  ****  * **  * ***                ****  ** * 

A0A8B7FJ73_BCL2L2-      aggggactacgggaacggc---------------------ctggagtctg
A0A8B7FJ73_BCL2L2-      aggggactacgggaacggc---------------------ctggagtctg
A0A8B7FJ73_BCL2L2-      agatgagttcgagacccgcttccggcgtaccttctctgatctggcagctc
A0A8B7FJ73_BCL2L2-      agatgagttcgagacccgcttccggcgtaccttctctgatctggcagctc
                        **  ** * ** ** * **                     ****   ** 

A0A8B7FJ73_BCL2L2-      ag--gaactggagcctggggagctgctgctggagcccgagccggagccc-
A0A8B7FJ73_BCL2L2-      ag--gaactggagcctgggga-----------------------------
A0A8B7FJ73_BCL2L2-      agctgcatgtgaccccaggctcagcccagcagcgcttcacccaggtctcc
A0A8B7FJ73_BCL2L2-      agctgcatgtgaccccaggctcagcccagcagcgcttcacccaggtctcc
                        **  * *   ** **  **                               

A0A8B7FJ73_BCL2L2-      -----------------gagcccgaagaggagccgccccggccccgcgcc
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      gatgaacttttccaagggggccccaactggggccgccttgtggccttctt
A0A8B7FJ73_BCL2L2-      gatgaacttttccaagggggccccaactggggccgccttgtggccttctt
                                                                          

A0A8B7FJ73_BCL2L2-      cccccgggagctccgggccctgggcctggctcgggagccccgggcagcca
A0A8B7FJ73_BCL2L2-      -----------------------------------------------cca
A0A8B7FJ73_BCL2L2-      c--------------gtctttggggctgcactgtgtgctgagagtgtcaa
A0A8B7FJ73_BCL2L2-      c--------------gtctttggggctgcactgtgtgctgagagtgtcaa
                                                                       * *

A0A8B7FJ73_BCL2L2-      ggaggaggaggag---------------gagccgggactggtcgagggtg
A0A8B7FJ73_BCL2L2-      ggaggaggaggag---------------gagccgggactggtcgagggtg
A0A8B7FJ73_BCL2L2-      caaggagatggagccactggtgggacaagtgcaggagtggatggtggcct
A0A8B7FJ73_BCL2L2-      caaggagatggagccactggtgggacaagtgcaggagtggatggtggcct
                          *****  ****               * ** **    * * * **   

A0A8B7FJ73_BCL2L2-      acccggggg-acgg-----------------cgccattgaggacccggag
A0A8B7FJ73_BCL2L2-      acccggggg-acgg-----------------cgccattgaggacccggag
A0A8B7FJ73_BCL2L2-      acctggagacacggctggccgactggatccacagcagtgggggctgggag
A0A8B7FJ73_BCL2L2-      acctggagacacggctggccgactggatccacagcagtgggggctgggcg
                        *** ** *  ****                 *  ** ** ** *  ** *

A0A8B7FJ73_BCL2L2-      ctggaagctatcaaagctc------gggtcagggagatggaggaagaagc
A0A8B7FJ73_BCL2L2-      ctggaagctatcaaagctc------gggtcagggagatggaggaagaagc
A0A8B7FJ73_BCL2L2-      ctggaagctatcaaagctc------gggtcagggagatggaggaagaagc
A0A8B7FJ73_BCL2L2-      ------gagttcacagctctatacggggacggggccctggaggagg----
                              *   *** *****      *** * ***   ******* *    

A0A8B7FJ73_BCL2L2-      tgagaagctaaaagagctacagaacgaggtagagaagcagatgaatatga
A0A8B7FJ73_BCL2L2-      tgagaagctaaaagagctacagaacgaggtagagaagcagatgaatatga
A0A8B7FJ73_BCL2L2-      tgagaagctaaaagagctacagaacgaggtagagaagcagatgaatatga
A0A8B7FJ73_BCL2L2-      ------------------------cgcgg---------------------
                                                ** **                     

A0A8B7FJ73_BCL2L2-      gtccacctccaggcaatgctggcccagtgattatgtccattgaagagaaa
A0A8B7FJ73_BCL2L2-      gtccacctccaggcaatgctggcccagtgattatgtccattgaagagaaa
A0A8B7FJ73_BCL2L2-      gtccacctccaggcaatgctggcccagtgattatgtccattgaagagaaa
A0A8B7FJ73_BCL2L2-      ---------------------------------cgtctgcgggaggggaa
                                                          ***    * ** * **

A0A8B7FJ73_BCL2L2-      atggaggctgatgcccgttccatctatgttggcaatgtggactatggtgc
A0A8B7FJ73_BCL2L2-      atggaggctgatgcccgttccatctatgttggcaatgtggactatggtgc
A0A8B7FJ73_BCL2L2-      atggaggctgatgcccgttccatctatgttggcaatgtggactatggtgc
A0A8B7FJ73_BCL2L2-      ctggg---------------catcagtgaggacagtgctgac--gggggc
                         ***                ****  **  * ** **  ***   ** **

A0A8B7FJ73_BCL2L2-      aacagcagaagagctggaagctcactttcatggctgtggttcagtcaacc
A0A8B7FJ73_BCL2L2-      aacagcagaagagctggaagctcactttcatggctgtggttcagtcaacc
A0A8B7FJ73_BCL2L2-      aacagcagaagagctggaagctcactttcatggctgtggttcagtcaacc
A0A8B7FJ73_BCL2L2-      cgtggca------ctgggggccc---------------------------
                            ***      ****  ** *                           

A0A8B7FJ73_BCL2L2-      gtgttaccatactgtgtgacaaatttagtggccatcccaaagggtttgca
A0A8B7FJ73_BCL2L2-      gtgttaccatactgtgtgacaaatttagtggccatcccaaagggtttgca
A0A8B7FJ73_BCL2L2-      gtgttaccatactgtgtgacaaatttagtggccatcccaaagggtttgca
A0A8B7FJ73_BCL2L2-      ----------------tggtaactgtaggggcctt---------------
                                        **  ** * *** **** *               

A0A8B7FJ73_BCL2L2-      tatatagagttctcagacaaagagtcagtgaggacttccctggccttaga
A0A8B7FJ73_BCL2L2-      tatatagagttctcagacaaagagtcagtgaggacttccctggccttaga
A0A8B7FJ73_BCL2L2-      tatatagagttctcagacaaagagtcagtgaggacttccctggccttaga
A0A8B7FJ73_BCL2L2-      ----------------------------------tttcgctagc------
                                                           *** ** **      

A0A8B7FJ73_BCL2L2-      tgagtccctatttagaggaagacaaatcaaggtgatcccaaaacgaacca
A0A8B7FJ73_BCL2L2-      tgagtccctatttagaggaagacaaatcaaggtgatcccaaaacgaacca
A0A8B7FJ73_BCL2L2-      tgagtccctatttagaggaagacaaatcaaggtgatcccaaaacgaacca
A0A8B7FJ73_BCL2L2-      -----------------------------aagtga---------------
                                                     * ****               

A0A8B7FJ73_BCL2L2-      acagaccaggcatcagcacaacagaccggggtttcccacgagcccgctac
A0A8B7FJ73_BCL2L2-      acagaccaggcatcagcacaacagaccggggtttcccacgagcccgctac
A0A8B7FJ73_BCL2L2-      acagaccaggcatcagcacaacagaccggggtttcccacgagcccgctac
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
                                                                          

A0A8B7FJ73_BCL2L2-      cgtgcccggactaccaactacaacagttcccgctctcgattctacagtgg
A0A8B7FJ73_BCL2L2-      cgtgcccggactaccaactacaacagttcccgctctcgattctacagtgg
A0A8B7FJ73_BCL2L2-      cgtgcccggactaccaactacaacagttcccgctctcgattctacagtgg
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
                                                                          

A0A8B7FJ73_BCL2L2-      ttttaacagcaggccccggggtcgagtctacaggggccgggctagagcga
A0A8B7FJ73_BCL2L2-      ttttaacagcaggccccggggtcgagtctacaggggccgggctagagcga
A0A8B7FJ73_BCL2L2-      ttttaacagcaggccccggggtcgagtctacaggggccgggctagagcga
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
                                                                          

A0A8B7FJ73_BCL2L2-      catcatggtattccccttactaa
A0A8B7FJ73_BCL2L2-      catcatggtattccccttactaa
A0A8B7FJ73_BCL2L2-      catcatggtattccccttactaa
A0A8B7FJ73_BCL2L2-      -----------------------
                                               

© 1998-2022Legal notice