Dataset for CDS BCL2L2 of organism Rhinopithecus roxellana

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6RW35_BCL2L2-      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
A0A2K6RW35_BCL2L2-      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
A0A2K6RW35_BCL2L2-      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
A0A2K6RW35_BCL2L2-      --------------------------------------------------

A0A2K6RW35_BCL2L2-      tttaggttataagctgaggcagaagggttatgtctgtggagctggccctg
A0A2K6RW35_BCL2L2-      tttaggttataagctgaggcagaagggttatgtctgtggagctggccctg
A0A2K6RW35_BCL2L2-      tttaggttataagctgaggcagaagggttatgtctgtggagctggccctg
A0A2K6RW35_BCL2L2-      --------------------------------------------------

A0A2K6RW35_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
A0A2K6RW35_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
A0A2K6RW35_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
A0A2K6RW35_BCL2L2-      --------------------------------------------------

A0A2K6RW35_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
A0A2K6RW35_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
A0A2K6RW35_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
A0A2K6RW35_BCL2L2-      --------------------------------------------------

A0A2K6RW35_BCL2L2-      gctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtctctg
A0A2K6RW35_BCL2L2-      gctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtctctg
A0A2K6RW35_BCL2L2-      gctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtctctg
A0A2K6RW35_BCL2L2-      --------------------------------------------------

A0A2K6RW35_BCL2L2-      atgaacttttccaagggggccccaactggggccgccttgtagccttcttt
A0A2K6RW35_BCL2L2-      atgaacttttccaagggggccccaactggggccgccttgtagccttcttt
A0A2K6RW35_BCL2L2-      atgaacttttccaagggggccccaactggggccgccttgtagccttcttt
A0A2K6RW35_BCL2L2-      --------------------------------------------------

A0A2K6RW35_BCL2L2-      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
A0A2K6RW35_BCL2L2-      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
A0A2K6RW35_BCL2L2-      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
A0A2K6RW35_BCL2L2-      --------------------------------------------------

A0A2K6RW35_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
A0A2K6RW35_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
A0A2K6RW35_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
A0A2K6RW35_BCL2L2-      --------------------------------------------------

A0A2K6RW35_BCL2L2-      tggctgactggatccacagcagtgggggctgggcg---------------
A0A2K6RW35_BCL2L2-      tggctgactggatccacagcagtgggggctgggcg---------------
A0A2K6RW35_BCL2L2-      tggctgactggatccacagcagtgggggctgggagctggaagctatcaaa
A0A2K6RW35_BCL2L2-      --------------------------------------------------

A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      gctcgagtcagggagatggaggaagaagctgagaagctaaaggagctaca
A0A2K6RW35_BCL2L2-      ---------------atggaggaagaagctgagaagctaaaggagctaca

A0A2K6RW35_BCL2L2-      ---------------------------gagttcacagctctatacgggga
A0A2K6RW35_BCL2L2-      ---------------------------gagttcacagctctatacgggga
A0A2K6RW35_BCL2L2-      gaacgaggtagagaagcagatgaatatgagtccac--ctccaggcaatgc
A0A2K6RW35_BCL2L2-      gaacgaggtagagaagcagatgaatatgagtccac--ctccaggcaatgc
                                                   **** ***  *** *  *   * 

A0A2K6RW35_BCL2L2-      cgg------------ggccctggaggaggcg-cggcgtctg---------
A0A2K6RW35_BCL2L2-      cgg------------ggccctggaggaggcg-cggcgtctg---------
A0A2K6RW35_BCL2L2-      tggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgtt
A0A2K6RW35_BCL2L2-      tggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgtt
                         **            * ** * ******  *  ** * ***         

A0A2K6RW35_BCL2L2-      ---------------------------------cgggaggggaactgg--
A0A2K6RW35_BCL2L2-      ---------------------------------cgggaggggaactgg--
A0A2K6RW35_BCL2L2-      ccatctatgttggcaatgtggactatggtgcaacagcagaagagctggaa
A0A2K6RW35_BCL2L2-      ccatctatgttggcaatgtggactatggtgcaacagcagaagagctggaa
                                                         * * **  ** ****  

A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      gctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtga
A0A2K6RW35_BCL2L2-      gctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtga

A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      caaatttagtggccatcccaaagggtttgcgtatatagagttctcagaca
A0A2K6RW35_BCL2L2-      caaatttagtggccatcccaaagggtttgcgtatatagagttctcagaca

A0A2K6RW35_BCL2L2-      --gcatcagtgaggac-----------------agtgctga---------
A0A2K6RW35_BCL2L2-      --gcatcagtgaggac-----------------agtgctga---------
A0A2K6RW35_BCL2L2-      aagagtcagtgaggacttccttggccttagatgagtccctatttagagga
A0A2K6RW35_BCL2L2-      aagagtcagtgaggacttccttggccttagatgagtccctatttagagga
                          *  ***********                 *** *  *         

A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      aggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcac
A0A2K6RW35_BCL2L2-      aggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcac

A0A2K6RW35_BCL2L2-      -------cgggg--------------gccgtggcactgggggccctggta
A0A2K6RW35_BCL2L2-      -------cgggg--------------gccgtggcactgggggccctggta
A0A2K6RW35_BCL2L2-      aacagaccggggttttccacgagcccgctaccgcgcccggaccaccaact
A0A2K6RW35_BCL2L2-      aacagaccggggttttccacgagcccgctaccgcgcccggaccaccaact
                               *****              **    ** *  **  * *     

A0A2K6RW35_BCL2L2-      actgtaggggccttttttgct-----------------agcaag------
A0A2K6RW35_BCL2L2-      actgtaggggccttttttgct-----------------agcaag------
A0A2K6RW35_BCL2L2-      acaacagttcccgctctcgcttctacagtggttttaacagcaggccccgg
A0A2K6RW35_BCL2L2-      acaacagttcccgctctcgcttctacagtggttttaacagcaggccccgg
                        **   **   **  * * ***                 **** *      

A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      ggtcgcgtctaca--ggtcaggatag------------------------
A0A2K6RW35_BCL2L2-      ggtcgcgtctacaggggccgggctagagcgacatcatggtattcccctta

A0A2K6RW35_BCL2L2-      -tga
A0A2K6RW35_BCL2L2-      -tga
A0A2K6RW35_BCL2L2-      ----
A0A2K6RW35_BCL2L2-      ctaa

© 1998-2023Legal notice